Incidental Mutation 'R5761:Usp35'
ID445305
Institutional Source Beutler Lab
Gene Symbol Usp35
Ensembl Gene ENSMUSG00000035713
Gene Nameubiquitin specific peptidase 35
SynonymsLOC381901, LOC244144
MMRRC Submission 043363-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R5761 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location97309380-97332020 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97312351 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 623 (V623I)
Ref Sequence ENSEMBL: ENSMUSP00000137927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004622] [ENSMUST00000139582] [ENSMUST00000168435]
Predicted Effect probably benign
Transcript: ENSMUST00000004622
SMART Domains Protein: ENSMUSP00000004622
Gene: ENSMUSG00000004508

DomainStartEndE-ValueType
PH 9 121 1.07e-22 SMART
Blast:PH 268 314 4e-11 BLAST
low complexity region 348 355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139582
AA Change: V623I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137726
Gene: ENSMUSG00000035713
AA Change: V623I

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
Pfam:UCH 440 915 5.2e-50 PFAM
Pfam:UCH_1 441 890 1.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168435
AA Change: V623I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137927
Gene: ENSMUSG00000035713
AA Change: V623I

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
Pfam:UCH 440 915 7.1e-48 PFAM
Pfam:UCH_1 441 890 7.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181651
SMART Domains Protein: ENSMUSP00000137720
Gene: ENSMUSG00000035713

DomainStartEndE-ValueType
Pfam:UCH 8 223 1e-24 PFAM
Pfam:UCH_1 9 196 5.7e-22 PFAM
low complexity region 236 247 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,210,101 V953D probably damaging Het
Abcb8 T C 5: 24,405,881 probably benign Het
Acad12 A T 5: 121,604,180 probably benign Het
Adam2 A T 14: 66,046,146 C436S probably damaging Het
Aebp2 T C 6: 140,624,217 probably benign Het
AI314180 T C 4: 58,853,131 I401M probably damaging Het
Akap8 A T 17: 32,317,185 C85S possibly damaging Het
Aldh1a3 C A 7: 66,419,179 R19L probably damaging Het
Baz2a A G 10: 128,119,690 T848A possibly damaging Het
Bud13 C T 9: 46,288,052 A237V probably benign Het
Cbarp CGCCTCTGCTGCCTCT CGCCTCT 10: 80,132,233 probably benign Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Ccz1 C T 5: 143,992,510 G367R probably damaging Het
Cep104 T C 4: 153,981,224 V56A possibly damaging Het
Chd6 C A 2: 160,957,078 R2362S probably damaging Het
Chd6 C T 2: 160,957,079 R2362K probably damaging Het
Cmc1 T C 9: 118,115,375 E25G probably benign Het
Cntnap5b T C 1: 100,446,894 S1123P probably damaging Het
Col4a3 T A 1: 82,716,057 L66* probably null Het
Crmp1 A G 5: 37,282,868 T329A probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp3a16 A G 5: 145,442,033 S393P possibly damaging Het
Cyp4f18 T A 8: 71,996,131 I225F probably damaging Het
Ddhd2 A G 8: 25,741,699 V432A probably benign Het
Foxq1 G A 13: 31,559,331 A139T probably damaging Het
Gm10428 G T 11: 62,753,343 probably benign Het
Gpr89 A G 3: 96,892,880 L134P probably damaging Het
Hfe2 T C 3: 96,528,622 S399P probably benign Het
Hrc A T 7: 45,336,601 probably null Het
Igf1r T A 7: 68,207,253 Y988N probably damaging Het
Igf2r A C 17: 12,698,352 probably null Het
Itga2b A G 11: 102,466,274 F260S probably benign Het
Kif2a T A 13: 106,962,164 N698I probably benign Het
Lap3 A C 5: 45,504,805 I316L probably benign Het
Map2k6 T G 11: 110,399,371 probably benign Het
Myh1 A G 11: 67,219,252 E1422G probably damaging Het
Ncoa6 A G 2: 155,408,141 V1081A probably benign Het
Nom1 A G 5: 29,437,641 E380G probably damaging Het
Nwd2 A T 5: 63,725,230 Y75F probably damaging Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Olfr645 G A 7: 104,084,169 R304W probably benign Het
Pkd1l1 A G 11: 8,916,301 V518A probably damaging Het
Ptgs2 A G 1: 150,105,528 M521V probably benign Het
Qsox1 T A 1: 155,779,528 M630L probably benign Het
Skiv2l2 T A 13: 112,917,662 I146F probably damaging Het
Spty2d1 A G 7: 46,998,284 L299P probably damaging Het
St6gal1 T G 16: 23,321,055 probably benign Het
Sult2a6 T C 7: 14,250,358 Y149C probably damaging Het
Tlr3 G A 8: 45,402,771 T124M probably benign Het
Tmem171 A G 13: 98,692,511 Y44H probably damaging Het
Vangl2 T A 1: 172,006,127 H463L probably damaging Het
Vmn1r175 A C 7: 23,808,480 L241V probably benign Het
Vmn1r19 A T 6: 57,405,353 K297I unknown Het
Vmn2r23 C A 6: 123,712,759 T198K probably benign Het
Vmn2r-ps69 T A 7: 85,304,015 noncoding transcript Het
Xirp2 A G 2: 67,510,967 Y1184C probably benign Het
Ythdc1 A G 5: 86,835,951 probably benign Het
Zbtb39 C T 10: 127,742,646 A363V probably damaging Het
Zmiz1 T A 14: 25,651,304 I527K possibly damaging Het
Zmiz1 C A 14: 25,651,306 P534T probably damaging Het
Other mutations in Usp35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03239:Usp35 APN 7 97321592 missense possibly damaging 0.62
R0046:Usp35 UTSW 7 97313597 splice site probably null
R0046:Usp35 UTSW 7 97313597 splice site probably null
R0739:Usp35 UTSW 7 97311667 nonsense probably null
R2655:Usp35 UTSW 7 97312147 missense probably benign
R3623:Usp35 UTSW 7 97312620 missense probably damaging 1.00
R4750:Usp35 UTSW 7 97310339 missense possibly damaging 0.85
R4967:Usp35 UTSW 7 97313575 missense probably damaging 1.00
R5317:Usp35 UTSW 7 97311639 missense probably damaging 0.99
R5341:Usp35 UTSW 7 97325927 missense probably damaging 1.00
R5894:Usp35 UTSW 7 97313077 missense probably damaging 1.00
R6113:Usp35 UTSW 7 97324326 missense probably damaging 1.00
R6282:Usp35 UTSW 7 97325948 missense probably damaging 1.00
R6454:Usp35 UTSW 7 97311560 missense probably damaging 0.98
R6454:Usp35 UTSW 7 97311644 nonsense probably null
R7142:Usp35 UTSW 7 97311547 missense probably damaging 0.97
R7158:Usp35 UTSW 7 97325964 start codon destroyed probably null 0.89
R7260:Usp35 UTSW 7 97320079 missense probably damaging 0.98
RF003:Usp35 UTSW 7 97322096 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TATGGGTCCCTGGTCCTAAG -3'
(R):5'- ACGTCGGTGGAGAAGATGTTC -3'

Sequencing Primer
(F):5'- GGTCCCTGGTCCTAAGCTGTC -3'
(R):5'- TTCGGAGGCAAGATTGTGACCC -3'
Posted On2016-11-21