Incidental Mutation 'R5771:Dnah7c'
ID445335
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Namedynein, axonemal, heavy chain 7C
SynonymsDnahc7c
MMRRC Submission 043371-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R5771 (G1)
Quality Score216
Status Not validated
Chromosome1
Chromosomal Location46425592-46807476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46639665 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1790 (V1790I)
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189749]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189339
Predicted Effect probably benign
Transcript: ENSMUST00000189749
AA Change: V1790I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: V1790I

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191499
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 95% (87/92)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,291,411 N1091K probably damaging Het
Adam3 C T 8: 24,707,411 V335I probably benign Het
AI504432 G A 3: 107,048,983 noncoding transcript Het
Apcdd1 A G 18: 62,936,956 Y98C probably damaging Het
Aqp9 C T 9: 71,122,864 A214T probably damaging Het
Atp8b4 T C 2: 126,378,744 D578G probably benign Het
Bcdin3d T C 15: 99,470,836 M161V probably benign Het
Bicral C T 17: 46,825,358 V309I possibly damaging Het
Ccdc88b C T 19: 6,853,835 A580T probably benign Het
Cdhr2 T A 13: 54,726,695 V860E probably damaging Het
Clhc1 A T 11: 29,563,854 N302Y possibly damaging Het
Cnnm2 T A 19: 46,856,995 probably null Het
Crebbp T C 16: 4,119,772 N709S probably benign Het
Ctnnal1 T C 4: 56,826,328 S512G probably benign Het
Dgcr8 C T 16: 18,272,768 V581I probably benign Het
Efl1 A G 7: 82,692,524 K452E probably benign Het
Epb42 A C 2: 121,021,820 V564G probably damaging Het
Etv4 G A 11: 101,771,456 P335S probably damaging Het
Fbxw9 T A 8: 85,064,572 probably null Het
Fcrls A T 3: 87,263,468 L3Q probably damaging Het
Frmd8 C A 19: 5,869,450 A190S probably benign Het
Gcm2 C T 13: 41,103,515 D253N probably benign Het
Gfm1 T C 3: 67,435,562 V143A probably benign Het
Gigyf2 T C 1: 87,446,328 M1226T possibly damaging Het
Gm10110 C T 14: 89,897,239 noncoding transcript Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm13757 A T 2: 88,446,308 V210D possibly damaging Het
Gm20939 T G 17: 94,874,339 C55W possibly damaging Het
Gm5407 T A 16: 49,296,866 noncoding transcript Het
Golga4 A G 9: 118,558,283 E1491G probably damaging Het
Hdac11 T A 6: 91,169,382 probably null Het
Hs3st3b1 C T 11: 63,889,272 S343N probably benign Het
Igkv12-44 G A 6: 69,815,091 P4S probably benign Het
Igkv1-35 C T 6: 70,011,247 V22I probably benign Het
Kcns2 A T 15: 34,838,922 T144S probably benign Het
Khdc1c T C 1: 21,369,042 V84A possibly damaging Het
Kif4-ps T A 12: 101,149,285 noncoding transcript Het
Lamc2 T G 1: 153,141,594 Y549S probably benign Het
Lect2 T A 13: 56,548,341 I8F probably benign Het
Loxl3 T A 6: 83,035,799 probably null Het
Lrwd1 A T 5: 136,123,662 I545N possibly damaging Het
Ltbp3 T C 19: 5,747,544 C437R probably damaging Het
Lypd3 T C 7: 24,640,362 S285P probably benign Het
Mast2 T A 4: 116,333,425 H83L possibly damaging Het
Mfsd4b4 A G 10: 39,892,639 F153L probably benign Het
Ms4a4b T A 19: 11,461,242 probably null Het
Nbr1 T A 11: 101,559,538 L41Q probably damaging Het
Nlrp4a G A 7: 26,453,389 C628Y probably damaging Het
Nup160 C T 2: 90,723,396 R1157C probably damaging Het
Obscn T A 11: 59,000,707 I7000F unknown Het
Olfr1287 T A 2: 111,450,061 probably null Het
Olfr1484 T G 19: 13,585,508 V25G probably damaging Het
Olfr194 TGAAGAAGAA TGAAGAA 16: 59,119,972 probably benign Het
Olfr229 A T 9: 39,910,250 Y149F probably damaging Het
Pdilt T C 7: 119,494,994 K345E probably damaging Het
Ppp1r12b A T 1: 134,773,424 probably null Het
Ppp2r1b A T 9: 50,866,832 Q219L probably damaging Het
Prim2 A G 1: 33,454,151 S485P unknown Het
Prkdc A G 16: 15,664,233 D380G probably damaging Het
Psmg1 A G 16: 95,982,169 L243S probably damaging Het
Rapgef5 T A 12: 117,721,326 V270D probably benign Het
Rnft1 C T 11: 86,493,206 R311* probably null Het
Scaper T A 9: 55,816,791 I628L probably damaging Het
Serpina3j C A 12: 104,314,926 H119Q possibly damaging Het
Slamf6 G A 1: 171,917,774 V23I probably damaging Het
Slc12a5 T A 2: 164,973,768 M45K possibly damaging Het
Slc25a11 A C 11: 70,646,190 V13G probably damaging Het
Slc7a14 T A 3: 31,238,707 Y143F probably damaging Het
Spryd3 A G 15: 102,116,907 probably benign Het
Stard13 C A 5: 151,190,011 L28F probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Taf2 A G 15: 55,059,939 V314A probably benign Het
Tas2r106 T C 6: 131,678,123 N255S possibly damaging Het
Tbxa2r T A 10: 81,332,941 W155R probably damaging Het
Tcf3 A G 10: 80,421,616 probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Vmn2r55 T C 7: 12,671,032 D148G probably damaging Het
Vmn2r77 A G 7: 86,812,027 N854D probably benign Het
Vstm4 A T 14: 32,904,569 H64L probably benign Het
Wdr92 A G 11: 17,224,638 T169A probably benign Het
Wnk2 T C 13: 49,102,800 T282A probably damaging Het
Zscan4c A T 7: 11,009,647 D391V probably benign Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46807289 missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46657111 missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46524117 missense probably benign 0.37
IGL03161:Dnah7c APN 1 46467296 missense probably benign 0.20
IGL03178:Dnah7c APN 1 46467365 missense probably benign
IGL03052:Dnah7c UTSW 1 46632149 missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46465905 missense probably benign
R1029:Dnah7c UTSW 1 46612721 missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46798279 missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46628911 missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46681817 missense probably damaging 1.00
R4133:Dnah7c UTSW 1 46665990 missense probably benign 0.01
R4303:Dnah7c UTSW 1 46748578 missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46649281 missense probably benign 0.33
R4434:Dnah7c UTSW 1 46666282 missense probably damaging 1.00
R4457:Dnah7c UTSW 1 46740621 missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46748635 missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46766611 missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46532931 missense probably benign 0.34
R4571:Dnah7c UTSW 1 46533216 missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46514583 nonsense probably null
R4731:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4733:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46533168 missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46793532 missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46688925 missense probably benign
R4875:Dnah7c UTSW 1 46688925 missense probably benign
R4916:Dnah7c UTSW 1 46595008 missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46530500 missense probably benign
R5279:Dnah7c UTSW 1 46519269 missense probably benign 0.14
R5327:Dnah7c UTSW 1 46665568 missense probably benign 0.05
R5546:Dnah7c UTSW 1 46666317 missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46798235 missense possibly damaging 0.84
R5637:Dnah7c UTSW 1 46760361 splice site probably null
R5639:Dnah7c UTSW 1 46739668 missense probably benign
R5663:Dnah7c UTSW 1 46535148 missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46748666 missense possibly damaging 0.47
R5759:Dnah7c UTSW 1 46615367 missense probably damaging 1.00
R5784:Dnah7c UTSW 1 46524068 missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46647015 missense probably benign 0.01
R5933:Dnah7c UTSW 1 46519215 missense probably damaging 1.00
R5948:Dnah7c UTSW 1 46672497 missense probably benign 0.21
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6487:Dnah7c UTSW 1 46769124 missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46658290 missense probably benign 0.00
R6614:Dnah7c UTSW 1 46649340 missense probably benign
R6614:Dnah7c UTSW 1 46649351 missense probably benign
R6615:Dnah7c UTSW 1 46515439 missense probably benign 0.01
R6615:Dnah7c UTSW 1 46649340 missense probably benign
R6615:Dnah7c UTSW 1 46649351 missense probably benign
R6649:Dnah7c UTSW 1 46649340 missense probably benign
R6649:Dnah7c UTSW 1 46649351 missense probably benign
R6650:Dnah7c UTSW 1 46649340 missense probably benign
R6650:Dnah7c UTSW 1 46649351 missense probably benign
R6651:Dnah7c UTSW 1 46649340 missense probably benign
R6651:Dnah7c UTSW 1 46649351 missense probably benign
R6653:Dnah7c UTSW 1 46649340 missense probably benign
R6653:Dnah7c UTSW 1 46649351 missense probably benign
R6714:Dnah7c UTSW 1 46740806 missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46672521 missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46649340 missense probably benign
R6760:Dnah7c UTSW 1 46649351 missense probably benign
R6763:Dnah7c UTSW 1 46628890 missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46657243 missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46527671 missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46666213 missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46455813 missense probably benign 0.07
R7007:Dnah7c UTSW 1 46532750 missense probably benign 0.04
R7086:Dnah7c UTSW 1 46750125 missense probably benign 0.00
R7128:Dnah7c UTSW 1 46527485 missense probably benign
R7131:Dnah7c UTSW 1 46681772 missense probably benign 0.00
R7135:Dnah7c UTSW 1 46533208 missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46680738 missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46430809 missense probably benign 0.00
R7221:Dnah7c UTSW 1 46455777 missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46596967 missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46780775 missense probably benign 0.31
R7319:Dnah7c UTSW 1 46784448 missense possibly damaging 0.95
R7404:Dnah7c UTSW 1 46666063 missense possibly damaging 0.52
R7452:Dnah7c UTSW 1 46647036 missense possibly damaging 0.91
R7515:Dnah7c UTSW 1 46457290 missense probably benign
R7534:Dnah7c UTSW 1 46770067 missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46784498 missense probably benign 0.00
R7605:Dnah7c UTSW 1 46632310 missense probably damaging 1.00
R7643:Dnah7c UTSW 1 46602813 missense probably benign
R7770:Dnah7c UTSW 1 46626300 intron probably null
R7884:Dnah7c UTSW 1 46791769 missense probably benign 0.23
R7899:Dnah7c UTSW 1 46514701 missense probably benign 0.00
R7967:Dnah7c UTSW 1 46791769 missense probably benign 0.23
R7982:Dnah7c UTSW 1 46514701 missense probably benign 0.00
R8025:Dnah7c UTSW 1 46457296 missense probably benign 0.01
R8057:Dnah7c UTSW 1 46688952 missense possibly damaging 0.52
Z1176:Dnah7c UTSW 1 46467302 missense probably benign 0.00
Z1176:Dnah7c UTSW 1 46615281 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46639665 missense probably benign
Z1176:Dnah7c UTSW 1 46646992 critical splice acceptor site probably null
Z1176:Dnah7c UTSW 1 46760316 missense possibly damaging 0.95
Z1177:Dnah7c UTSW 1 46654103 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AATGGAACGTTTTGAGCAGTAC -3'
(R):5'- CCTGAGAAGATTTGCACCAAG -3'

Sequencing Primer
(F):5'- GTACTTGGATGCTAACCAACACGTG -3'
(R):5'- CTGAGAAGATTTGCACCAAGGAAAAG -3'
Posted On2016-11-21