Mutagenetix > Incidental Mutation

Incidental Mutation 'R5771:Golga4'

445372

Institutional Source

Beutler Lab

Gene Symbol

Golga4

Ensembl Gene

ENSMUSG00000038708

Gene Name

golgi autoantigen, golgin subfamily a, 4

Synonyms

golgin-245, Olp-1

MMRRC Submission

043371-MU

Accession Numbers

Genbank: NM_018748; MGI: 1859646

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5771 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118506267-118582519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118558283 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1491 (E1491G)

Ref Sequence

ENSEMBL: ENSMUSP00000081880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]

AlphaFold

Q91VW5

Predicted Effect

probably damaging
Transcript: ENSMUST00000084820
AA Change: E1491G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: E1491G

Domain	Start	End	E-Value	Type
low complexity region	10	41	N/A	INTRINSIC
coiled coil region	157	241	N/A	INTRINSIC
internal_repeat_1	271	299	2.93e-5	PROSPERO
low complexity region	339	351	N/A	INTRINSIC
low complexity region	513	532	N/A	INTRINSIC
low complexity region	547	566	N/A	INTRINSIC
low complexity region	705	715	N/A	INTRINSIC
low complexity region	739	755	N/A	INTRINSIC
low complexity region	882	895	N/A	INTRINSIC
SCOP:d1epua_	940	1076	2e-3	SMART
low complexity region	1138	1152	N/A	INTRINSIC
low complexity region	1161	1182	N/A	INTRINSIC
low complexity region	1204	1228	N/A	INTRINSIC
coiled coil region	1283	1496	N/A	INTRINSIC
internal_repeat_2	1500	1525	5.98e-5	PROSPERO
coiled coil region	1541	1715	N/A	INTRINSIC
low complexity region	1756	1778	N/A	INTRINSIC
internal_repeat_1	1811	1839	2.93e-5	PROSPERO
coiled coil region	1844	1883	N/A	INTRINSIC
internal_repeat_2	1899	1924	5.98e-5	PROSPERO
coiled coil region	1933	2160	N/A	INTRINSIC
Grip	2181	2225	1.38e-16	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000211840
AA Change: E501G

Predicted Effect

probably benign
Transcript: ENSMUST00000212097

Predicted Effect

probably benign
Transcript: ENSMUST00000212183

Predicted Effect

probably benign
Transcript: ENSMUST00000212274

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212913

Meta Mutation Damage Score

0.1182

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.8%

Validation Efficiency

95% (87/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]

Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,291,411	N1091K	probably damaging	Het
Adam3	C	T	8: 24,707,411	V335I	probably benign	Het
AI504432	G	A	3: 107,048,983		noncoding transcript	Het
Apcdd1	A	G	18: 62,936,956	Y98C	probably damaging	Het
Aqp9	C	T	9: 71,122,864	A214T	probably damaging	Het
Atp8b4	T	C	2: 126,378,744	D578G	probably benign	Het
Bcdin3d	T	C	15: 99,470,836	M161V	probably benign	Het
Bicral	C	T	17: 46,825,358	V309I	possibly damaging	Het
Ccdc88b	C	T	19: 6,853,835	A580T	probably benign	Het
Cdhr2	T	A	13: 54,726,695	V860E	probably damaging	Het
Clhc1	A	T	11: 29,563,854	N302Y	possibly damaging	Het
Cnnm2	T	A	19: 46,856,995		probably null	Het
Crebbp	T	C	16: 4,119,772	N709S	probably benign	Het
Ctnnal1	T	C	4: 56,826,328	S512G	probably benign	Het
Dgcr8	C	T	16: 18,272,768	V581I	probably benign	Het
Dnah7c	G	A	1: 46,639,665	V1790I	probably benign	Het
Efl1	A	G	7: 82,692,524	K452E	probably benign	Het
Epb42	A	C	2: 121,021,820	V564G	probably damaging	Het
Etv4	G	A	11: 101,771,456	P335S	probably damaging	Het
Fbxw9	T	A	8: 85,064,572		probably null	Het
Fcrls	A	T	3: 87,263,468	L3Q	probably damaging	Het
Frmd8	C	A	19: 5,869,450	A190S	probably benign	Het
Gcm2	C	T	13: 41,103,515	D253N	probably benign	Het
Gfm1	T	C	3: 67,435,562	V143A	probably benign	Het
Gigyf2	T	C	1: 87,446,328	M1226T	possibly damaging	Het
Gm10110	C	T	14: 89,897,239		noncoding transcript	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gm13757	A	T	2: 88,446,308	V210D	possibly damaging	Het
Gm20939	T	G	17: 94,874,339	C55W	possibly damaging	Het
Gm5407	T	A	16: 49,296,866		noncoding transcript	Het
Hdac11	T	A	6: 91,169,382		probably null	Het
Hs3st3b1	C	T	11: 63,889,272	S343N	probably benign	Het
Igkv12-44	G	A	6: 69,815,091	P4S	probably benign	Het
Igkv1-35	C	T	6: 70,011,247	V22I	probably benign	Het
Kcns2	A	T	15: 34,838,922	T144S	probably benign	Het
Khdc1c	T	C	1: 21,369,042	V84A	possibly damaging	Het
Kif4-ps	T	A	12: 101,149,285		noncoding transcript	Het
Lamc2	T	G	1: 153,141,594	Y549S	probably benign	Het
Lect2	T	A	13: 56,548,341	I8F	probably benign	Het
Loxl3	T	A	6: 83,035,799		probably null	Het
Lrwd1	A	T	5: 136,123,662	I545N	possibly damaging	Het
Ltbp3	T	C	19: 5,747,544	C437R	probably damaging	Het
Lypd3	T	C	7: 24,640,362	S285P	probably benign	Het
Mast2	T	A	4: 116,333,425	H83L	possibly damaging	Het
Mfsd4b4	A	G	10: 39,892,639	F153L	probably benign	Het
Ms4a4b	T	A	19: 11,461,242		probably null	Het
Nbr1	T	A	11: 101,559,538	L41Q	probably damaging	Het
Nlrp4a	G	A	7: 26,453,389	C628Y	probably damaging	Het
Nup160	C	T	2: 90,723,396	R1157C	probably damaging	Het
Obscn	T	A	11: 59,000,707	I7000F	unknown	Het
Olfr1287	T	A	2: 111,450,061		probably null	Het
Olfr1484	T	G	19: 13,585,508	V25G	probably damaging	Het
Olfr194	TGAAGAAGAA	TGAAGAA	16: 59,119,972		probably benign	Het
Olfr229	A	T	9: 39,910,250	Y149F	probably damaging	Het
Pdilt	T	C	7: 119,494,994	K345E	probably damaging	Het
Ppp1r12b	A	T	1: 134,773,424		probably null	Het
Ppp2r1b	A	T	9: 50,866,832	Q219L	probably damaging	Het
Prim2	A	G	1: 33,454,151	S485P	unknown	Het
Prkdc	A	G	16: 15,664,233	D380G	probably damaging	Het
Psmg1	A	G	16: 95,982,169	L243S	probably damaging	Het
Rapgef5	T	A	12: 117,721,326	V270D	probably benign	Het
Rnft1	C	T	11: 86,493,206	R311*	probably null	Het
Scaper	T	A	9: 55,816,791	I628L	probably damaging	Het
Serpina3j	C	A	12: 104,314,926	H119Q	possibly damaging	Het
Slamf6	G	A	1: 171,917,774	V23I	probably damaging	Het
Slc12a5	T	A	2: 164,973,768	M45K	possibly damaging	Het
Slc25a11	A	C	11: 70,646,190	V13G	probably damaging	Het
Slc7a14	T	A	3: 31,238,707	Y143F	probably damaging	Het
Spryd3	A	G	15: 102,116,907		probably benign	Het
Stard13	C	A	5: 151,190,011	L28F	probably damaging	Het
Susd2	C	T	10: 75,638,019	A581T	probably damaging	Het
Taf2	A	G	15: 55,059,939	V314A	probably benign	Het
Tas2r106	T	C	6: 131,678,123	N255S	possibly damaging	Het
Tbxa2r	T	A	10: 81,332,941	W155R	probably damaging	Het
Tcf3	A	G	10: 80,421,616		probably benign	Het
Ticam1	TCACACA	TCACA	17: 56,270,629		probably null	Het
Vmn2r55	T	C	7: 12,671,032	D148G	probably damaging	Het
Vmn2r77	A	G	7: 86,812,027	N854D	probably benign	Het
Vstm4	A	T	14: 32,904,569	H64L	probably benign	Het
Wdr92	A	G	11: 17,224,638	T169A	probably benign	Het
Wnk2	T	C	13: 49,102,800	T282A	probably damaging	Het
Zscan4c	A	T	7: 11,009,647	D391V	probably benign	Het

Other mutations in Golga4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00711:Golga4	APN	9	118514271	critical splice donor site	probably null
IGL00801:Golga4	APN	9	118538926	missense	probably damaging	0.98
IGL01395:Golga4	APN	9	118535373	missense	probably damaging	1.00
IGL01472:Golga4	APN	9	118532574	missense	probably damaging	1.00
IGL01519:Golga4	APN	9	118527092	missense	probably damaging	1.00
IGL01563:Golga4	APN	9	118527006	splice site	probably benign
IGL02593:Golga4	APN	9	118555566	unclassified	probably benign
IGL02803:Golga4	APN	9	118535460	missense	probably benign
IGL02939:Golga4	APN	9	118535454	missense	probably benign	0.01
IGL02939:Golga4	APN	9	118534632	missense	probably damaging	1.00
IGL03123:Golga4	APN	9	118536885	missense	probably damaging	1.00
IGL03334:Golga4	APN	9	118537233	splice site	probably benign
F5770:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62
F6893:Golga4	UTSW	9	118553457	missense	probably damaging	1.00
PIT4382001:Golga4	UTSW	9	118553453	missense	possibly damaging	0.88
R0179:Golga4	UTSW	9	118560740	critical splice acceptor site	probably null
R0279:Golga4	UTSW	9	118568993	missense	probably benign	0.00
R0362:Golga4	UTSW	9	118555785	missense	probably benign	0.13
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0974:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R1128:Golga4	UTSW	9	118548784	missense	probably benign	0.40
R1384:Golga4	UTSW	9	118565651	missense	probably damaging	0.99
R1435:Golga4	UTSW	9	118535440	missense	probably benign	0.00
R1513:Golga4	UTSW	9	118555732	missense	probably benign	0.02
R1818:Golga4	UTSW	9	118572987	missense	probably damaging	1.00
R2083:Golga4	UTSW	9	118532590	missense	probably damaging	1.00
R2243:Golga4	UTSW	9	118556904	missense	probably benign	0.06
R2355:Golga4	UTSW	9	118560742	missense	probably benign	0.00
R2518:Golga4	UTSW	9	118556612	missense	probably damaging	1.00
R2921:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2922:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2923:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R3121:Golga4	UTSW	9	118557380	missense	possibly damaging	0.68
R3424:Golga4	UTSW	9	118534647	missense	probably benign	0.16
R3909:Golga4	UTSW	9	118558736	missense	possibly damaging	0.82
R3913:Golga4	UTSW	9	118538971	missense	probably damaging	0.99
R4321:Golga4	UTSW	9	118556435	missense	probably damaging	1.00
R4358:Golga4	UTSW	9	118551878	missense	probably benign	0.16
R4483:Golga4	UTSW	9	118514186	missense	probably damaging	1.00
R4515:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4518:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4519:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4545:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4546:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4580:Golga4	UTSW	9	118557259	missense	probably benign	0.00
R4918:Golga4	UTSW	9	118558145	missense	probably damaging	1.00
R5007:Golga4	UTSW	9	118558300	missense	probably benign
R5045:Golga4	UTSW	9	118565656	missense	probably benign
R5232:Golga4	UTSW	9	118506558	critical splice donor site	probably null
R5256:Golga4	UTSW	9	118556501	missense	possibly damaging	0.93
R5502:Golga4	UTSW	9	118559057	nonsense	probably null
R5567:Golga4	UTSW	9	118558183	missense	probably damaging	1.00
R5576:Golga4	UTSW	9	118553534	missense	probably benign	0.13
R5807:Golga4	UTSW	9	118527130	missense	probably damaging	0.99
R5860:Golga4	UTSW	9	118558106	missense	probably damaging	1.00
R6012:Golga4	UTSW	9	118559696	missense	possibly damaging	0.90
R6285:Golga4	UTSW	9	118558627	nonsense	probably null
R6299:Golga4	UTSW	9	118557370	missense	probably benign	0.03
R6467:Golga4	UTSW	9	118536792	missense	probably damaging	1.00
R6552:Golga4	UTSW	9	118514231	missense	probably damaging	1.00
R6688:Golga4	UTSW	9	118514210	missense	possibly damaging	0.66
R6965:Golga4	UTSW	9	118548779	missense	probably damaging	1.00
R6987:Golga4	UTSW	9	118558532	missense	probably benign
R7212:Golga4	UTSW	9	118536840	missense	possibly damaging	0.80
R7426:Golga4	UTSW	9	118559495	missense	probably benign
R7431:Golga4	UTSW	9	118559731	missense	probably damaging	1.00
R7641:Golga4	UTSW	9	118557575	missense	probably benign	0.05
R7727:Golga4	UTSW	9	118548702	missense	probably damaging	1.00
R7729:Golga4	UTSW	9	118556063	missense	possibly damaging	0.51
R7811:Golga4	UTSW	9	118532575	missense	probably damaging	1.00
R7849:Golga4	UTSW	9	118559311	missense	possibly damaging	0.93
R7891:Golga4	UTSW	9	118556366	missense	probably damaging	1.00
R7976:Golga4	UTSW	9	118536768	missense	possibly damaging	0.49
R8275:Golga4	UTSW	9	118532559	missense	probably damaging	1.00
R8378:Golga4	UTSW	9	118558322	missense	probably benign	0.03
R8514:Golga4	UTSW	9	118555796	missense	possibly damaging	0.47
R8698:Golga4	UTSW	9	118555961	missense	probably damaging	0.97
R8856:Golga4	UTSW	9	118556711	missense	probably damaging	0.98
R9227:Golga4	UTSW	9	118556873	missense	possibly damaging	0.94
R9282:Golga4	UTSW	9	118556825	missense	probably damaging	1.00
RF022:Golga4	UTSW	9	118557989	missense	probably damaging	1.00
V7583:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- TGAAAGTCGATGCTCTGAGTAAAG -3'
(R):5'- TGAAGTCTCTGAACCAGCCC -3'

Sequencing Primer
(F):5'- GAGAAAATGTCTGCCCTTGAGC -3'
(R):5'- TCTGAACCAGCCCACTGTG -3'

Posted On

2016-11-21