Incidental Mutation 'R5771:Slc25a11'
ID445383
Institutional Source Beutler Lab
Gene Symbol Slc25a11
Ensembl Gene ENSMUSG00000014606
Gene Namesolute carrier family 25 (mitochondrial carrier oxoglutarate carrier), member 11
Synonyms2310022P18Rik, 2oxoc
MMRRC Submission 043371-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R5771 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70644196-70647479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 70646190 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 13 (V13G)
Ref Sequence ENSEMBL: ENSMUSP00000120900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014750] [ENSMUST00000037534] [ENSMUST00000055184] [ENSMUST00000108551] [ENSMUST00000136383] [ENSMUST00000139638] [ENSMUST00000141695] [ENSMUST00000152160]
Predicted Effect probably benign
Transcript: ENSMUST00000014750
AA Change: V45G

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000014750
Gene: ENSMUSG00000014606
AA Change: V45G

DomainStartEndE-ValueType
Pfam:Mito_carr 18 112 1.3e-22 PFAM
Pfam:Mito_carr 115 213 2.6e-19 PFAM
Pfam:Mito_carr 216 311 5.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037534
SMART Domains Protein: ENSMUSP00000036472
Gene: ENSMUSG00000040746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PA 53 150 1.4e-14 PFAM
transmembrane domain 172 194 N/A INTRINSIC
RING 230 271 2.65e-9 SMART
low complexity region 278 303 N/A INTRINSIC
low complexity region 332 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055184
SMART Domains Protein: ENSMUSP00000057563
Gene: ENSMUSG00000050675

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRRNT 19 51 1.66e-1 SMART
LRR 70 91 2.54e2 SMART
LRR 92 114 9.96e-1 SMART
LRR_TYP 115 138 1.56e-2 SMART
LRR_TYP 139 162 1.47e-3 SMART
LRR 163 186 1.89e-1 SMART
LRR 187 210 8.09e-1 SMART
LRRCT 221 281 2.53e-12 SMART
low complexity region 403 432 N/A INTRINSIC
low complexity region 446 530 N/A INTRINSIC
low complexity region 533 579 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
PDB:2BP3|T 680 701 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000108551
SMART Domains Protein: ENSMUSP00000104191
Gene: ENSMUSG00000050675

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRRNT 19 51 1.66e-1 SMART
LRR 70 91 2.54e2 SMART
LRR 92 114 9.96e-1 SMART
LRR_TYP 115 138 1.56e-2 SMART
LRR_TYP 139 162 1.47e-3 SMART
LRR 163 186 1.89e-1 SMART
LRR 187 210 8.09e-1 SMART
LRRCT 221 281 2.53e-12 SMART
low complexity region 403 432 N/A INTRINSIC
low complexity region 446 530 N/A INTRINSIC
low complexity region 533 579 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
PDB:2BP3|T 680 701 2e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134804
Predicted Effect probably damaging
Transcript: ENSMUST00000136383
AA Change: V13G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120900
Gene: ENSMUSG00000014606
AA Change: V13G

DomainStartEndE-ValueType
Pfam:Mito_carr 1 75 9.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139638
AA Change: V13G

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114685
Gene: ENSMUSG00000014606
AA Change: V13G

DomainStartEndE-ValueType
Pfam:Mito_carr 1 80 7.4e-17 PFAM
Pfam:Mito_carr 83 181 1.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141537
Predicted Effect probably benign
Transcript: ENSMUST00000141695
SMART Domains Protein: ENSMUSP00000121511
Gene: ENSMUSG00000040746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151034
Predicted Effect probably benign
Transcript: ENSMUST00000152160
SMART Domains Protein: ENSMUSP00000115057
Gene: ENSMUSG00000040746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157076
Meta Mutation Damage Score 0.5472 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 95% (87/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The oxoglutarate/malate carrier transports 2-oxoglutarate across the inner membranes of mitochondria in an electroneutral exchange for malate or other dicarboxylic acids (summary by Iacobazzi et al., 1992 [PubMed 1457818]).[supplied by OMIM, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,291,411 N1091K probably damaging Het
Adam3 C T 8: 24,707,411 V335I probably benign Het
AI504432 G A 3: 107,048,983 noncoding transcript Het
Apcdd1 A G 18: 62,936,956 Y98C probably damaging Het
Aqp9 C T 9: 71,122,864 A214T probably damaging Het
Atp8b4 T C 2: 126,378,744 D578G probably benign Het
Bcdin3d T C 15: 99,470,836 M161V probably benign Het
Bicral C T 17: 46,825,358 V309I possibly damaging Het
Ccdc88b C T 19: 6,853,835 A580T probably benign Het
Cdhr2 T A 13: 54,726,695 V860E probably damaging Het
Clhc1 A T 11: 29,563,854 N302Y possibly damaging Het
Cnnm2 T A 19: 46,856,995 probably null Het
Crebbp T C 16: 4,119,772 N709S probably benign Het
Ctnnal1 T C 4: 56,826,328 S512G probably benign Het
Dgcr8 C T 16: 18,272,768 V581I probably benign Het
Dnah7c G A 1: 46,639,665 V1790I probably benign Het
Efl1 A G 7: 82,692,524 K452E probably benign Het
Epb42 A C 2: 121,021,820 V564G probably damaging Het
Etv4 G A 11: 101,771,456 P335S probably damaging Het
Fbxw9 T A 8: 85,064,572 probably null Het
Fcrls A T 3: 87,263,468 L3Q probably damaging Het
Frmd8 C A 19: 5,869,450 A190S probably benign Het
Gcm2 C T 13: 41,103,515 D253N probably benign Het
Gfm1 T C 3: 67,435,562 V143A probably benign Het
Gigyf2 T C 1: 87,446,328 M1226T possibly damaging Het
Gm10110 C T 14: 89,897,239 noncoding transcript Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm13757 A T 2: 88,446,308 V210D possibly damaging Het
Gm20939 T G 17: 94,874,339 C55W possibly damaging Het
Gm5407 T A 16: 49,296,866 noncoding transcript Het
Golga4 A G 9: 118,558,283 E1491G probably damaging Het
Hdac11 T A 6: 91,169,382 probably null Het
Hs3st3b1 C T 11: 63,889,272 S343N probably benign Het
Igkv12-44 G A 6: 69,815,091 P4S probably benign Het
Igkv1-35 C T 6: 70,011,247 V22I probably benign Het
Kcns2 A T 15: 34,838,922 T144S probably benign Het
Khdc1c T C 1: 21,369,042 V84A possibly damaging Het
Kif4-ps T A 12: 101,149,285 noncoding transcript Het
Lamc2 T G 1: 153,141,594 Y549S probably benign Het
Lect2 T A 13: 56,548,341 I8F probably benign Het
Loxl3 T A 6: 83,035,799 probably null Het
Lrwd1 A T 5: 136,123,662 I545N possibly damaging Het
Ltbp3 T C 19: 5,747,544 C437R probably damaging Het
Lypd3 T C 7: 24,640,362 S285P probably benign Het
Mast2 T A 4: 116,333,425 H83L possibly damaging Het
Mfsd4b4 A G 10: 39,892,639 F153L probably benign Het
Ms4a4b T A 19: 11,461,242 probably null Het
Nbr1 T A 11: 101,559,538 L41Q probably damaging Het
Nlrp4a G A 7: 26,453,389 C628Y probably damaging Het
Nup160 C T 2: 90,723,396 R1157C probably damaging Het
Obscn T A 11: 59,000,707 I7000F unknown Het
Olfr1287 T A 2: 111,450,061 probably null Het
Olfr1484 T G 19: 13,585,508 V25G probably damaging Het
Olfr194 TGAAGAAGAA TGAAGAA 16: 59,119,972 probably benign Het
Olfr229 A T 9: 39,910,250 Y149F probably damaging Het
Pdilt T C 7: 119,494,994 K345E probably damaging Het
Ppp1r12b A T 1: 134,773,424 probably null Het
Ppp2r1b A T 9: 50,866,832 Q219L probably damaging Het
Prim2 A G 1: 33,454,151 S485P unknown Het
Prkdc A G 16: 15,664,233 D380G probably damaging Het
Psmg1 A G 16: 95,982,169 L243S probably damaging Het
Rapgef5 T A 12: 117,721,326 V270D probably benign Het
Rnft1 C T 11: 86,493,206 R311* probably null Het
Scaper T A 9: 55,816,791 I628L probably damaging Het
Serpina3j C A 12: 104,314,926 H119Q possibly damaging Het
Slamf6 G A 1: 171,917,774 V23I probably damaging Het
Slc12a5 T A 2: 164,973,768 M45K possibly damaging Het
Slc7a14 T A 3: 31,238,707 Y143F probably damaging Het
Spryd3 A G 15: 102,116,907 probably benign Het
Stard13 C A 5: 151,190,011 L28F probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Taf2 A G 15: 55,059,939 V314A probably benign Het
Tas2r106 T C 6: 131,678,123 N255S possibly damaging Het
Tbxa2r T A 10: 81,332,941 W155R probably damaging Het
Tcf3 A G 10: 80,421,616 probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Vmn2r55 T C 7: 12,671,032 D148G probably damaging Het
Vmn2r77 A G 7: 86,812,027 N854D probably benign Het
Vstm4 A T 14: 32,904,569 H64L probably benign Het
Wdr92 A G 11: 17,224,638 T169A probably benign Het
Wnk2 T C 13: 49,102,800 T282A probably damaging Het
Zscan4c A T 7: 11,009,647 D391V probably benign Het
Other mutations in Slc25a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03087:Slc25a11 APN 11 70645207 missense probably benign 0.09
IGL03348:Slc25a11 APN 11 70645344 unclassified probably benign
R0448:Slc25a11 UTSW 11 70645579 missense probably benign 0.43
R1368:Slc25a11 UTSW 11 70645526 splice site probably null
R1505:Slc25a11 UTSW 11 70646824 missense probably benign
R1781:Slc25a11 UTSW 11 70644825 missense probably benign 0.44
R1970:Slc25a11 UTSW 11 70646173 missense probably benign 0.25
R2508:Slc25a11 UTSW 11 70645832 missense possibly damaging 0.95
R4397:Slc25a11 UTSW 11 70644851 missense probably benign 0.01
R4747:Slc25a11 UTSW 11 70645956 missense possibly damaging 0.95
R5177:Slc25a11 UTSW 11 70645817 missense probably damaging 1.00
R5243:Slc25a11 UTSW 11 70646098 missense probably damaging 1.00
R5296:Slc25a11 UTSW 11 70646185 missense probably damaging 0.97
R5510:Slc25a11 UTSW 11 70645535 missense probably damaging 1.00
R5662:Slc25a11 UTSW 11 70645419 nonsense probably null
R7287:Slc25a11 UTSW 11 70645355 missense probably benign
R7799:Slc25a11 UTSW 11 70645179 missense probably benign
R7860:Slc25a11 UTSW 11 70645179 missense probably benign
R7943:Slc25a11 UTSW 11 70645179 missense probably benign
Z1177:Slc25a11 UTSW 11 70644845 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TAGAAATGTCAGCACATCAGGCC -3'
(R):5'- CTTACTGGGCAACTGGACTC -3'

Sequencing Primer
(F):5'- ACATCAGGCCAAGGTCTGG -3'
(R):5'- GGCAACTGGACTCTTTTGC -3'
Posted On2016-11-21