Incidental Mutation 'R5771:Gcm2'
ID 445391
Institutional Source Beutler Lab
Gene Symbol Gcm2
Ensembl Gene ENSMUSG00000021362
Gene Name glial cells missing homolog 2
Synonyms Gcm1-rs2
MMRRC Submission 043371-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.735) question?
Stock # R5771 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 41254903-41264511 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 41256991 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 253 (D253N)
Ref Sequence ENSEMBL: ENSMUSP00000021791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021791] [ENSMUST00000225271]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000021791
AA Change: D253N

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021791
Gene: ENSMUSG00000021362
AA Change: D253N

DomainStartEndE-ValueType
Pfam:GCM 35 172 4.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225420
Meta Mutation Damage Score 0.0905 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 95% (87/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a homolog of the Drosophila glial cells missing gene, which is thought to act as a binary switch between neuronal and glial cell determination. The protein encoded by this gene contains a conserved N-terminal GCM motif that has DNA-binding activity. The protein is a transcription factor that acts as a master regulator of parathyroid development. It has been suggested that this transcription factor might mediate the effect of calcium on parathyroid hormone expression and secretion in parathyroid cells. Mutations in this gene are associated with hypoparathyroidism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice lack parathyroid glands and exhibit hypocalcemia, hypophosphatemia, a mild abnormal bone phenotype, and partial perinatal lethality. Hypoparathyroidism is observed although parathyroid hormone serum levels are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,241,411 (GRCm39) N1091K probably damaging Het
Adam3 C T 8: 25,197,427 (GRCm39) V335I probably benign Het
AI504432 G A 3: 106,956,299 (GRCm39) noncoding transcript Het
Apcdd1 A G 18: 63,070,027 (GRCm39) Y98C probably damaging Het
Aqp9 C T 9: 71,030,146 (GRCm39) A214T probably damaging Het
Atp8b4 T C 2: 126,220,664 (GRCm39) D578G probably benign Het
Bcdin3d T C 15: 99,368,717 (GRCm39) M161V probably benign Het
Bicral C T 17: 47,136,284 (GRCm39) V309I possibly damaging Het
Ccdc88b C T 19: 6,831,203 (GRCm39) A580T probably benign Het
Cdhr2 T A 13: 54,874,508 (GRCm39) V860E probably damaging Het
Clhc1 A T 11: 29,513,854 (GRCm39) N302Y possibly damaging Het
Cnnm2 T A 19: 46,845,434 (GRCm39) probably null Het
Crebbp T C 16: 3,937,636 (GRCm39) N709S probably benign Het
Ctnnal1 T C 4: 56,826,328 (GRCm39) S512G probably benign Het
Dgcr8 C T 16: 18,090,632 (GRCm39) V581I probably benign Het
Dnaaf10 A G 11: 17,174,638 (GRCm39) T169A probably benign Het
Dnah7c G A 1: 46,678,825 (GRCm39) V1790I probably benign Het
Efl1 A G 7: 82,341,732 (GRCm39) K452E probably benign Het
Epb42 A C 2: 120,852,301 (GRCm39) V564G probably damaging Het
Etv4 G A 11: 101,662,282 (GRCm39) P335S probably damaging Het
Fbxw9 T A 8: 85,791,201 (GRCm39) probably null Het
Fcrl2 A T 3: 87,170,775 (GRCm39) L3Q probably damaging Het
Frmd8 C A 19: 5,919,478 (GRCm39) A190S probably benign Het
Gfm1 T C 3: 67,342,895 (GRCm39) V143A probably benign Het
Gigyf2 T C 1: 87,374,050 (GRCm39) M1226T possibly damaging Het
Gm10110 C T 14: 90,134,675 (GRCm39) noncoding transcript Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gm20939 T G 17: 95,181,767 (GRCm39) C55W possibly damaging Het
Gm5407 T A 16: 49,117,229 (GRCm39) noncoding transcript Het
Golga4 A G 9: 118,387,351 (GRCm39) E1491G probably damaging Het
Hdac11 T A 6: 91,146,364 (GRCm39) probably null Het
Hs3st3b1 C T 11: 63,780,098 (GRCm39) S343N probably benign Het
Igkv12-44 G A 6: 69,792,075 (GRCm39) P4S probably benign Het
Igkv1-35 C T 6: 69,988,231 (GRCm39) V22I probably benign Het
Kcns2 A T 15: 34,839,068 (GRCm39) T144S probably benign Het
Khdc1c T C 1: 21,439,266 (GRCm39) V84A possibly damaging Het
Kif4-ps T A 12: 101,115,544 (GRCm39) noncoding transcript Het
Lamc2 T G 1: 153,017,340 (GRCm39) Y549S probably benign Het
Lect2 T A 13: 56,696,154 (GRCm39) I8F probably benign Het
Loxl3 T A 6: 83,012,780 (GRCm39) probably null Het
Lrwd1 A T 5: 136,152,516 (GRCm39) I545N possibly damaging Het
Ltbp3 T C 19: 5,797,572 (GRCm39) C437R probably damaging Het
Lypd3 T C 7: 24,339,787 (GRCm39) S285P probably benign Het
Mast2 T A 4: 116,190,622 (GRCm39) H83L possibly damaging Het
Mfsd4b4 A G 10: 39,768,635 (GRCm39) F153L probably benign Het
Ms4a4b T A 19: 11,438,606 (GRCm39) probably null Het
Nbr1 T A 11: 101,450,364 (GRCm39) L41Q probably damaging Het
Nlrp4a G A 7: 26,152,814 (GRCm39) C628Y probably damaging Het
Nup160 C T 2: 90,553,740 (GRCm39) R1157C probably damaging Het
Obscn T A 11: 58,891,533 (GRCm39) I7000F unknown Het
Or4k41 T A 2: 111,280,406 (GRCm39) probably null Het
Or4p21 A T 2: 88,276,652 (GRCm39) V210D possibly damaging Het
Or5ac15 TGAAGAAGAA TGAAGAA 16: 58,940,335 (GRCm39) probably benign Het
Or5b122 T G 19: 13,562,872 (GRCm39) V25G probably damaging Het
Or8g2 A T 9: 39,821,546 (GRCm39) Y149F probably damaging Het
Pdilt T C 7: 119,094,217 (GRCm39) K345E probably damaging Het
Ppp1r12b A T 1: 134,701,162 (GRCm39) probably null Het
Ppp2r1b A T 9: 50,778,132 (GRCm39) Q219L probably damaging Het
Prim2 A G 1: 33,493,232 (GRCm39) S485P unknown Het
Prkdc A G 16: 15,482,097 (GRCm39) D380G probably damaging Het
Psmg1 A G 16: 95,783,369 (GRCm39) L243S probably damaging Het
Rapgef5 T A 12: 117,685,061 (GRCm39) V270D probably benign Het
Rnft1 C T 11: 86,384,032 (GRCm39) R311* probably null Het
Scaper T A 9: 55,724,075 (GRCm39) I628L probably damaging Het
Serpina3j C A 12: 104,281,185 (GRCm39) H119Q possibly damaging Het
Slamf6 G A 1: 171,745,341 (GRCm39) V23I probably damaging Het
Slc12a5 T A 2: 164,815,688 (GRCm39) M45K possibly damaging Het
Slc25a11 A C 11: 70,537,016 (GRCm39) V13G probably damaging Het
Slc7a14 T A 3: 31,292,856 (GRCm39) Y143F probably damaging Het
Spryd3 A G 15: 102,025,342 (GRCm39) probably benign Het
Stard13 C A 5: 151,113,476 (GRCm39) L28F probably damaging Het
Susd2 C T 10: 75,473,853 (GRCm39) A581T probably damaging Het
Taf2 A G 15: 54,923,335 (GRCm39) V314A probably benign Het
Tas2r106 T C 6: 131,655,086 (GRCm39) N255S possibly damaging Het
Tbxa2r T A 10: 81,168,775 (GRCm39) W155R probably damaging Het
Tcf3 A G 10: 80,257,450 (GRCm39) probably benign Het
Ticam1 TCACACA TCACA 17: 56,577,629 (GRCm39) probably null Het
Vmn2r55 T C 7: 12,404,959 (GRCm39) D148G probably damaging Het
Vmn2r77 A G 7: 86,461,235 (GRCm39) N854D probably benign Het
Vstm4 A T 14: 32,626,526 (GRCm39) H64L probably benign Het
Wnk2 T C 13: 49,256,276 (GRCm39) T282A probably damaging Het
Zscan4c A T 7: 10,743,574 (GRCm39) D391V probably benign Het
Other mutations in Gcm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Gcm2 APN 13 41,256,607 (GRCm39) missense probably damaging 1.00
IGL01476:Gcm2 APN 13 41,259,217 (GRCm39) missense probably damaging 1.00
IGL02034:Gcm2 APN 13 41,259,269 (GRCm39) missense probably damaging 1.00
IGL02186:Gcm2 APN 13 41,258,125 (GRCm39) missense possibly damaging 0.93
IGL02456:Gcm2 APN 13 41,256,477 (GRCm39) missense probably benign 0.01
IGL03142:Gcm2 APN 13 41,256,711 (GRCm39) missense probably benign 0.01
IGL03184:Gcm2 APN 13 41,258,888 (GRCm39) missense probably damaging 1.00
PIT4403001:Gcm2 UTSW 13 41,256,315 (GRCm39) missense probably benign 0.01
R0227:Gcm2 UTSW 13 41,259,332 (GRCm39) missense probably damaging 0.99
R1061:Gcm2 UTSW 13 41,259,347 (GRCm39) missense probably damaging 1.00
R1813:Gcm2 UTSW 13 41,259,367 (GRCm39) missense probably benign 0.19
R2057:Gcm2 UTSW 13 41,263,430 (GRCm39) start codon destroyed probably null 0.28
R2058:Gcm2 UTSW 13 41,263,430 (GRCm39) start codon destroyed probably null 0.28
R2059:Gcm2 UTSW 13 41,263,430 (GRCm39) start codon destroyed probably null 0.28
R2351:Gcm2 UTSW 13 41,257,094 (GRCm39) missense probably benign 0.02
R4653:Gcm2 UTSW 13 41,256,317 (GRCm39) missense probably benign 0.21
R4782:Gcm2 UTSW 13 41,256,970 (GRCm39) missense possibly damaging 0.66
R4799:Gcm2 UTSW 13 41,256,970 (GRCm39) missense possibly damaging 0.66
R5135:Gcm2 UTSW 13 41,256,435 (GRCm39) missense probably benign
R5162:Gcm2 UTSW 13 41,257,131 (GRCm39) missense probably benign 0.01
R5665:Gcm2 UTSW 13 41,263,387 (GRCm39) missense possibly damaging 0.73
R5756:Gcm2 UTSW 13 41,263,372 (GRCm39) missense probably damaging 1.00
R5928:Gcm2 UTSW 13 41,256,874 (GRCm39) missense probably benign 0.00
R5977:Gcm2 UTSW 13 41,256,603 (GRCm39) missense probably damaging 0.99
R6394:Gcm2 UTSW 13 41,263,373 (GRCm39) missense probably damaging 1.00
R6578:Gcm2 UTSW 13 41,259,154 (GRCm39) missense probably damaging 1.00
R6798:Gcm2 UTSW 13 41,259,361 (GRCm39) missense probably damaging 1.00
R7088:Gcm2 UTSW 13 41,256,840 (GRCm39) missense probably damaging 0.98
R7413:Gcm2 UTSW 13 41,259,230 (GRCm39) missense probably damaging 1.00
R7456:Gcm2 UTSW 13 41,256,751 (GRCm39) missense probably benign 0.02
R8293:Gcm2 UTSW 13 41,256,646 (GRCm39) missense probably damaging 1.00
R8738:Gcm2 UTSW 13 41,258,096 (GRCm39) missense probably benign 0.41
R9087:Gcm2 UTSW 13 41,263,406 (GRCm39) missense
R9316:Gcm2 UTSW 13 41,259,328 (GRCm39) missense probably damaging 1.00
R9799:Gcm2 UTSW 13 41,258,924 (GRCm39) missense probably damaging 1.00
Z1088:Gcm2 UTSW 13 41,256,268 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAGCTGTGAAATCCAAGGTTC -3'
(R):5'- GAAGCACTCAGGACATCAGG -3'

Sequencing Primer
(F):5'- AAGGTTCTCTCATAGCTGCCATAGG -3'
(R):5'- GGGGACACCTCAATAGCACG -3'
Posted On 2016-11-21