Mutagenetix > Incidental Mutation

Incidental Mutation 'R0027:Zic2'

44540

Institutional Source

Beutler Lab

Gene Symbol

Zic2

Ensembl Gene

ENSMUSG00000061524

Gene Name

zinc finger protein of the cerebellum 2

Synonyms

odd-paired homolog, GENA 29, Ku

MMRRC Submission

038322-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.899) question?

Stock #

R0027 (G1) of strain 730

Quality Score

163

Status

Validated

Chromosome

Chromosomal Location

122712847-122717264 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 122713755 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 223 (M223T)

Ref Sequence

ENSEMBL: ENSMUSP00000075283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075888]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075888
AA Change: M223T

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000075283
Gene: ENSMUSG00000061524
AA Change: M223T

Domain	Start	End	E-Value	Type
low complexity region	18	33	N/A	INTRINSIC
low complexity region	81	103	N/A	INTRINSIC
low complexity region	131	150	N/A	INTRINSIC
low complexity region	215	241	N/A	INTRINSIC
ZnF_C2H2	265	290	5.68e1	SMART
ZnF_C2H2	299	326	6.92e0	SMART
ZnF_C2H2	332	356	8.02e-5	SMART
ZnF_C2H2	362	386	1.69e-3	SMART
ZnF_C2H2	392	414	4.54e-4	SMART
low complexity region	416	434	N/A	INTRINSIC
low complexity region	455	519	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135485

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137059

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177306

Meta Mutation Damage Score

0.0808

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]
PHENOTYPE: Defects in neurulation and forebrain development have been identified in both targeted and ENU induced homozygous mutants. Death occurs perinatally in the targeted mouse and during midgestation in the ENU mouse. Mice homozygous for a knock-down allele exhibit cognitive and social behavior defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts12	A	T	15: 11,285,959 (GRCm39)	I723F	probably damaging	Het
Anapc1	G	T	2: 128,483,431 (GRCm39)	D1221E	possibly damaging	Het
Arhgef28	T	A	13: 98,082,204 (GRCm39)	E1201V	possibly damaging	Het
Capn12	T	A	7: 28,581,385 (GRCm39)	H79Q	probably benign	Het
Caprin1	A	T	2: 103,605,925 (GRCm39)		probably benign	Het
Carmil3	T	A	14: 55,731,860 (GRCm39)	F196Y	probably damaging	Het
Casp8ap2	A	G	4: 32,643,810 (GRCm39)	H961R	probably benign	Het
Cdkl3	C	T	11: 51,923,176 (GRCm39)		probably benign	Het
Cic	T	A	7: 24,986,565 (GRCm39)	S1299T	probably damaging	Het
Cic	C	A	7: 24,986,566 (GRCm39)	S1299Y	probably damaging	Het
Col13a1	A	G	10: 61,685,940 (GRCm39)	L684P	unknown	Het
D430041D05Rik	A	T	2: 104,085,389 (GRCm39)	F1053L	probably benign	Het
Dab1	T	C	4: 104,561,396 (GRCm39)		probably benign	Het
Dmxl1	A	T	18: 50,090,362 (GRCm39)		probably benign	Het
Dst	C	T	1: 34,228,200 (GRCm39)	P1606L	probably damaging	Het
Eml1	T	C	12: 108,502,557 (GRCm39)	C708R	possibly damaging	Het
Fam131b	T	A	6: 42,295,182 (GRCm39)	M304L	probably benign	Het
Foxk1	A	T	5: 142,436,095 (GRCm39)	I321F	probably damaging	Het
Gm10306	C	T	4: 94,445,027 (GRCm39)		probably benign	Het
Gm10985	TA	TANA	3: 53,752,677 (GRCm39)		probably null	Het
Gse1	T	C	8: 121,293,285 (GRCm39)		probably benign	Het
Hcn3	A	G	3: 89,067,132 (GRCm39)	S79P	probably damaging	Het
Hspa4	T	A	11: 53,174,412 (GRCm39)	M203L	probably benign	Het
Ints15	G	A	5: 143,293,817 (GRCm39)	T220I	probably damaging	Het
Kctd7	G	A	5: 130,181,414 (GRCm39)	R279H	probably damaging	Het
Kif11	C	T	19: 37,395,431 (GRCm39)		probably benign	Het
Klf13	T	C	7: 63,541,509 (GRCm39)	N206S	probably benign	Het
Kpna7	A	T	5: 144,926,507 (GRCm39)	Y482N	probably damaging	Het
Lamc1	T	C	1: 153,138,329 (GRCm39)	Y175C	probably damaging	Het
Lrpprc	G	A	17: 85,074,435 (GRCm39)	R491*	probably null	Het
Madd	T	A	2: 90,982,894 (GRCm39)	I1350F	probably damaging	Het
Mbtd1	T	C	11: 93,815,375 (GRCm39)	V321A	possibly damaging	Het
Mon2	G	A	10: 122,871,953 (GRCm39)	S357L	possibly damaging	Het
Ndst3	A	G	3: 123,465,162 (GRCm39)	V270A	probably damaging	Het
Nlrp2	T	C	7: 5,325,447 (GRCm39)	T742A	probably damaging	Het
Nopchap1	G	A	10: 83,200,393 (GRCm39)		probably benign	Het
Or6d14	T	C	6: 116,533,910 (GRCm39)	S175P	probably damaging	Het
Papola	A	C	12: 105,799,395 (GRCm39)	S675R	probably benign	Het
Pcdh9	T	A	14: 94,126,081 (GRCm39)	I30F	probably null	Het
Prl6a1	T	A	13: 27,502,011 (GRCm39)	L126Q	probably damaging	Het
Prr29	A	G	11: 106,267,102 (GRCm39)	E89G	possibly damaging	Het
Psmd1	T	C	1: 86,021,987 (GRCm39)		probably benign	Het
Rad9b	A	G	5: 122,489,786 (GRCm39)		probably benign	Het
Rest	T	C	5: 77,430,398 (GRCm39)	V939A	probably benign	Het
Rnf135	T	A	11: 80,084,768 (GRCm39)	S180R	probably benign	Het
Sarm1	C	A	11: 78,378,917 (GRCm39)	R376L	probably damaging	Het
Scap	C	A	9: 110,208,798 (GRCm39)	P613Q	probably benign	Het
Scube3	C	T	17: 28,383,331 (GRCm39)	R374*	probably null	Het
Setx	T	G	2: 29,029,233 (GRCm39)	V167G	probably damaging	Het
Snrnp40	T	A	4: 130,262,066 (GRCm39)	H151Q	probably damaging	Het
Sox21	G	T	14: 118,473,029 (GRCm39)	H7N	probably benign	Het
Stard9	A	T	2: 120,533,982 (GRCm39)	Q3413L	probably benign	Het
Sycp1	A	G	3: 102,803,226 (GRCm39)	V528A	probably benign	Het
Tcl1b3	A	T	12: 105,157,498 (GRCm39)	S47C	probably damaging	Het
Treml4	T	C	17: 48,571,962 (GRCm39)	S122P	possibly damaging	Het
Trip11	C	T	12: 101,851,428 (GRCm39)	A879T	probably benign	Het
Ubr4	C	A	4: 139,127,704 (GRCm39)	N567K	probably damaging	Het
Zan	T	C	5: 137,404,781 (GRCm39)		probably benign	Het
Zfp804a	G	A	2: 82,087,544 (GRCm39)	D458N	probably damaging	Het

Other mutations in Zic2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00816:Zic2	APN	14	122,715,971 (GRCm39)	nonsense	probably null
IGL01607:Zic2	APN	14	122,716,294 (GRCm39)	splice site	probably benign
IGL02307:Zic2	APN	14	122,714,046 (GRCm39)	missense	possibly damaging	0.76
IGL02311:Zic2	APN	14	122,713,606 (GRCm39)	missense	probably damaging	0.99
IGL02561:Zic2	APN	14	122,715,957 (GRCm39)	nonsense	probably null
IGL02982:Zic2	APN	14	122,715,979 (GRCm39)	missense	probably damaging	0.98
R0001:Zic2	UTSW	14	122,716,369 (GRCm39)	missense	probably damaging	0.99
R0136:Zic2	UTSW	14	122,713,953 (GRCm39)	missense	probably damaging	0.96
R0310:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0418:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0420:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0421:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0518:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0520:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0521:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0628:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R1733:Zic2	UTSW	14	122,716,359 (GRCm39)	missense	probably damaging	0.97
R1757:Zic2	UTSW	14	122,716,031 (GRCm39)	missense	possibly damaging	0.86
R2398:Zic2	UTSW	14	122,716,329 (GRCm39)	nonsense	probably null
R5323:Zic2	UTSW	14	122,713,728 (GRCm39)	missense	probably damaging	1.00
R5381:Zic2	UTSW	14	122,713,227 (GRCm39)	missense	probably damaging	0.97
R6930:Zic2	UTSW	14	122,713,869 (GRCm39)	missense	probably damaging	0.99
R7223:Zic2	UTSW	14	122,713,503 (GRCm39)	missense	probably damaging	0.98
R8750:Zic2	UTSW	14	122,714,129 (GRCm39)	missense	probably benign	0.06
R8852:Zic2	UTSW	14	122,713,530 (GRCm39)	missense	possibly damaging	0.92
R8860:Zic2	UTSW	14	122,713,530 (GRCm39)	missense	possibly damaging	0.92
Z1088:Zic2	UTSW	14	122,716,087 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AACGTGCTCAATGGGCAAATGC -3'
(R):5'- AAAACAAGCCCTGGCTGTCCTG -3'

Sequencing Primer
(F):5'- AGCAATACCGCCAAGTGG -3'
(R):5'- cacacacacacacacacacG -3'

Posted On

2013-06-11