Incidental Mutation 'R5771:Crebbp'
ID445403
Institutional Source Beutler Lab
Gene Symbol Crebbp
Ensembl Gene ENSMUSG00000022521
Gene NameCREB binding protein
SynonymsKAT3A, CBP
MMRRC Submission 043371-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5771 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4081328-4213997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4119772 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 709 (N709S)
Ref Sequence ENSEMBL: ENSMUSP00000146330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023165] [ENSMUST00000205344] [ENSMUST00000205765]
Predicted Effect probably benign
Transcript: ENSMUST00000023165
AA Change: N747S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000023165
Gene: ENSMUSG00000022521
AA Change: N747S

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 213 233 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
ZnF_TAZ 347 432 2.31e-32 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:KIX 586 666 1.4e-42 PFAM
low complexity region 874 893 N/A INTRINSIC
low complexity region 909 958 N/A INTRINSIC
low complexity region 1045 1065 N/A INTRINSIC
BROMO 1085 1195 4.26e-43 SMART
Blast:KAT11 1265 1308 3e-15 BLAST
KAT11 1343 1649 4.25e-137 SMART
ZnF_ZZ 1702 1743 2.17e-15 SMART
ZnF_TAZ 1767 1845 6.8e-30 SMART
low complexity region 1847 1877 N/A INTRINSIC
low complexity region 1884 1914 N/A INTRINSIC
low complexity region 1942 1971 N/A INTRINSIC
Pfam:Creb_binding 2019 2115 8.2e-38 PFAM
low complexity region 2147 2161 N/A INTRINSIC
low complexity region 2197 2216 N/A INTRINSIC
low complexity region 2260 2279 N/A INTRINSIC
low complexity region 2286 2304 N/A INTRINSIC
low complexity region 2343 2378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205344
AA Change: N283S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect unknown
Transcript: ENSMUST00000205685
AA Change: N170S
Predicted Effect probably benign
Transcript: ENSMUST00000205765
AA Change: N709S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0714 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 95% (87/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is ubiquitously expressed and is involved in the transcriptional coactivation of many different transcription factors. First isolated as a nuclear protein that binds to cAMP-response element binding protein (CREB), this gene is now known to play critical roles in embryonic development, growth control, and homeostasis by coupling chromatin remodeling to transcription factor recognition. The protein encoded by this gene has intrinsic histone acetyltransferase activity and also acts as a scaffold to stabilize additional protein interactions with the transcription complex. This protein acetylates both histone and non-histone proteins. This protein shares regions of very high sequence similarity with protein p300 in its bromodomain, cysteine-histidine-rich regions, and histone acetyltransferase domain. Mutations in this gene cause Rubinstein-Taybi syndrome (RTS). Chromosomal translocations involving this gene have been associated with acute myeloid leukemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for null or altered alleles die around midgestation with defects in hemopoiesis, blood vessel formation, and neural tube closure. Heterozygotes may exhibit skeletal, cardiac, and hematopoietic defects, retarded growth, and hematologic tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,291,411 N1091K probably damaging Het
Adam3 C T 8: 24,707,411 V335I probably benign Het
AI504432 G A 3: 107,048,983 noncoding transcript Het
Apcdd1 A G 18: 62,936,956 Y98C probably damaging Het
Aqp9 C T 9: 71,122,864 A214T probably damaging Het
Atp8b4 T C 2: 126,378,744 D578G probably benign Het
Bcdin3d T C 15: 99,470,836 M161V probably benign Het
Bicral C T 17: 46,825,358 V309I possibly damaging Het
Ccdc88b C T 19: 6,853,835 A580T probably benign Het
Cdhr2 T A 13: 54,726,695 V860E probably damaging Het
Clhc1 A T 11: 29,563,854 N302Y possibly damaging Het
Cnnm2 T A 19: 46,856,995 probably null Het
Ctnnal1 T C 4: 56,826,328 S512G probably benign Het
Dgcr8 C T 16: 18,272,768 V581I probably benign Het
Dnah7c G A 1: 46,639,665 V1790I probably benign Het
Efl1 A G 7: 82,692,524 K452E probably benign Het
Epb42 A C 2: 121,021,820 V564G probably damaging Het
Etv4 G A 11: 101,771,456 P335S probably damaging Het
Fbxw9 T A 8: 85,064,572 probably null Het
Fcrls A T 3: 87,263,468 L3Q probably damaging Het
Frmd8 C A 19: 5,869,450 A190S probably benign Het
Gcm2 C T 13: 41,103,515 D253N probably benign Het
Gfm1 T C 3: 67,435,562 V143A probably benign Het
Gigyf2 T C 1: 87,446,328 M1226T possibly damaging Het
Gm10110 C T 14: 89,897,239 noncoding transcript Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm13757 A T 2: 88,446,308 V210D possibly damaging Het
Gm20939 T G 17: 94,874,339 C55W possibly damaging Het
Gm5407 T A 16: 49,296,866 noncoding transcript Het
Golga4 A G 9: 118,558,283 E1491G probably damaging Het
Hdac11 T A 6: 91,169,382 probably null Het
Hs3st3b1 C T 11: 63,889,272 S343N probably benign Het
Igkv12-44 G A 6: 69,815,091 P4S probably benign Het
Igkv1-35 C T 6: 70,011,247 V22I probably benign Het
Kcns2 A T 15: 34,838,922 T144S probably benign Het
Khdc1c T C 1: 21,369,042 V84A possibly damaging Het
Kif4-ps T A 12: 101,149,285 noncoding transcript Het
Lamc2 T G 1: 153,141,594 Y549S probably benign Het
Lect2 T A 13: 56,548,341 I8F probably benign Het
Loxl3 T A 6: 83,035,799 probably null Het
Lrwd1 A T 5: 136,123,662 I545N possibly damaging Het
Ltbp3 T C 19: 5,747,544 C437R probably damaging Het
Lypd3 T C 7: 24,640,362 S285P probably benign Het
Mast2 T A 4: 116,333,425 H83L possibly damaging Het
Mfsd4b4 A G 10: 39,892,639 F153L probably benign Het
Ms4a4b T A 19: 11,461,242 probably null Het
Nbr1 T A 11: 101,559,538 L41Q probably damaging Het
Nlrp4a G A 7: 26,453,389 C628Y probably damaging Het
Nup160 C T 2: 90,723,396 R1157C probably damaging Het
Obscn T A 11: 59,000,707 I7000F unknown Het
Olfr1287 T A 2: 111,450,061 probably null Het
Olfr1484 T G 19: 13,585,508 V25G probably damaging Het
Olfr194 TGAAGAAGAA TGAAGAA 16: 59,119,972 probably benign Het
Olfr229 A T 9: 39,910,250 Y149F probably damaging Het
Pdilt T C 7: 119,494,994 K345E probably damaging Het
Ppp1r12b A T 1: 134,773,424 probably null Het
Ppp2r1b A T 9: 50,866,832 Q219L probably damaging Het
Prim2 A G 1: 33,454,151 S485P unknown Het
Prkdc A G 16: 15,664,233 D380G probably damaging Het
Psmg1 A G 16: 95,982,169 L243S probably damaging Het
Rapgef5 T A 12: 117,721,326 V270D probably benign Het
Rnft1 C T 11: 86,493,206 R311* probably null Het
Scaper T A 9: 55,816,791 I628L probably damaging Het
Serpina3j C A 12: 104,314,926 H119Q possibly damaging Het
Slamf6 G A 1: 171,917,774 V23I probably damaging Het
Slc12a5 T A 2: 164,973,768 M45K possibly damaging Het
Slc25a11 A C 11: 70,646,190 V13G probably damaging Het
Slc7a14 T A 3: 31,238,707 Y143F probably damaging Het
Spryd3 A G 15: 102,116,907 probably benign Het
Stard13 C A 5: 151,190,011 L28F probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Taf2 A G 15: 55,059,939 V314A probably benign Het
Tas2r106 T C 6: 131,678,123 N255S possibly damaging Het
Tbxa2r T A 10: 81,332,941 W155R probably damaging Het
Tcf3 A G 10: 80,421,616 probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Vmn2r55 T C 7: 12,671,032 D148G probably damaging Het
Vmn2r77 A G 7: 86,812,027 N854D probably benign Het
Vstm4 A T 14: 32,904,569 H64L probably benign Het
Wdr92 A G 11: 17,224,638 T169A probably benign Het
Wnk2 T C 13: 49,102,800 T282A probably damaging Het
Zscan4c A T 7: 11,009,647 D391V probably benign Het
Other mutations in Crebbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Crebbp APN 16 4179552 missense probably benign
IGL01366:Crebbp APN 16 4126506 missense probably damaging 1.00
IGL01457:Crebbp APN 16 4124768 missense probably damaging 0.99
IGL01713:Crebbp APN 16 4128648 missense possibly damaging 0.79
IGL02382:Crebbp APN 16 4108070 missense probably damaging 1.00
IGL02513:Crebbp APN 16 4126605 unclassified probably null
IGL02519:Crebbp APN 16 4101593 missense possibly damaging 0.80
IGL02533:Crebbp APN 16 4107432 missense probably damaging 1.00
IGL02582:Crebbp APN 16 4084277 missense possibly damaging 0.87
IGL02600:Crebbp APN 16 4155018 missense probably benign
IGL02716:Crebbp APN 16 4114878 missense probably benign 0.22
IGL02736:Crebbp APN 16 4154910 missense probably benign 0.00
IGL03349:Crebbp APN 16 4117358 missense possibly damaging 0.69
Intriguing UTSW 16 4180022 missense possibly damaging 0.83
Suggestive UTSW 16 4108127 missense probably damaging 1.00
PIT4418001:Crebbp UTSW 16 4114825 missense probably benign 0.02
R0022:Crebbp UTSW 16 4085228 missense probably damaging 1.00
R0029:Crebbp UTSW 16 4117443 missense probably damaging 1.00
R0098:Crebbp UTSW 16 4091928 missense probably damaging 1.00
R0098:Crebbp UTSW 16 4091928 missense probably damaging 1.00
R0125:Crebbp UTSW 16 4117241 splice site probably benign
R0126:Crebbp UTSW 16 4084063 missense possibly damaging 0.94
R0140:Crebbp UTSW 16 4117499 missense probably damaging 1.00
R0546:Crebbp UTSW 16 4085807 missense probably damaging 0.99
R0705:Crebbp UTSW 16 4155010 missense possibly damaging 0.95
R0801:Crebbp UTSW 16 4088276 missense probably damaging 1.00
R1103:Crebbp UTSW 16 4084061 missense probably damaging 0.97
R1225:Crebbp UTSW 16 4126956 missense probably benign 0.04
R1421:Crebbp UTSW 16 4124647 missense probably damaging 1.00
R1513:Crebbp UTSW 16 4115885 missense probably damaging 1.00
R1531:Crebbp UTSW 16 4084517 missense probably benign 0.04
R1860:Crebbp UTSW 16 4087736 missense possibly damaging 0.68
R1941:Crebbp UTSW 16 4179691 missense probably benign
R1953:Crebbp UTSW 16 4179449 missense probably benign 0.23
R1992:Crebbp UTSW 16 4128697 splice site probably null
R2000:Crebbp UTSW 16 4084252 missense probably damaging 0.98
R2006:Crebbp UTSW 16 4084753 unclassified probably benign
R2022:Crebbp UTSW 16 4085819 missense probably damaging 1.00
R2044:Crebbp UTSW 16 4084823 missense probably benign 0.04
R2185:Crebbp UTSW 16 4084138 missense probably damaging 0.99
R2203:Crebbp UTSW 16 4138777 missense possibly damaging 0.72
R2349:Crebbp UTSW 16 4138910 missense probably damaging 1.00
R2430:Crebbp UTSW 16 4096465 missense probably damaging 1.00
R2438:Crebbp UTSW 16 4154858 missense possibly damaging 0.90
R2842:Crebbp UTSW 16 4109198 missense probably damaging 1.00
R2896:Crebbp UTSW 16 4138816 missense probably damaging 1.00
R2920:Crebbp UTSW 16 4119082 missense probably damaging 0.98
R3118:Crebbp UTSW 16 4109198 missense probably damaging 1.00
R3894:Crebbp UTSW 16 4096102 missense probably benign 0.11
R4177:Crebbp UTSW 16 4119799 missense possibly damaging 0.48
R4692:Crebbp UTSW 16 4114863 missense possibly damaging 0.64
R4790:Crebbp UTSW 16 4180119 missense probably damaging 0.98
R4884:Crebbp UTSW 16 4088375 missense probably damaging 1.00
R4957:Crebbp UTSW 16 4117367 missense probably benign 0.14
R5109:Crebbp UTSW 16 4088431 intron probably benign
R5121:Crebbp UTSW 16 4093511 missense probably damaging 1.00
R5420:Crebbp UTSW 16 4107458 missense probably damaging 1.00
R5455:Crebbp UTSW 16 4085967 missense probably benign 0.45
R5485:Crebbp UTSW 16 4114913 missense probably benign
R5660:Crebbp UTSW 16 4154858 missense possibly damaging 0.90
R5724:Crebbp UTSW 16 4087635 unclassified probably benign
R5825:Crebbp UTSW 16 4087742 missense probably damaging 0.99
R5919:Crebbp UTSW 16 4108127 missense probably damaging 1.00
R5965:Crebbp UTSW 16 4087661 unclassified probably benign
R6021:Crebbp UTSW 16 4085418 missense probably damaging 1.00
R6146:Crebbp UTSW 16 4084623 nonsense probably null
R6521:Crebbp UTSW 16 4119128 missense probably damaging 0.99
R6571:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6617:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6618:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6634:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6646:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6647:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6766:Crebbp UTSW 16 4117500 missense probably damaging 1.00
R6836:Crebbp UTSW 16 4180022 missense possibly damaging 0.83
R7022:Crebbp UTSW 16 4117323 missense probably damaging 0.98
R7210:Crebbp UTSW 16 4084257 missense possibly damaging 0.95
R7568:Crebbp UTSW 16 4126489 missense probably benign 0.34
R7672:Crebbp UTSW 16 4084710 missense probably benign 0.06
X0012:Crebbp UTSW 16 4087765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAATCCTGTTTGTTGGCTAG -3'
(R):5'- ACTACAGTCTGCTCTGATTTGC -3'

Sequencing Primer
(F):5'- TGTTGGCTAGTTTAAGAAAACAAGG -3'
(R):5'- CTACAGTCTGCTCTGATTTGCTTGTG -3'
Posted On2016-11-21