Mutagenetix > Incidental Mutation

Incidental Mutation 'R5772:Dis3l2'

445419

Institutional Source

Beutler Lab

Gene Symbol

Dis3l2

Ensembl Gene

ENSMUSG00000053333

Gene Name

DIS3 like 3'-5' exoribonuclease 2

Synonyms

4930429A22Rik, 8030493P09Rik

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.358) question?

Stock #

R5772 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86703808-87050095 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 86878432 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 325 (G325D)

Ref Sequence

ENSEMBL: ENSMUSP00000070506 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065694] [ENSMUST00000168237] [ENSMUST00000190618]

AlphaFold

Q8CI75

PDB Structure

Structure of mouse Dis3L2 in complex with oligoU RNA substrate [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000065694
AA Change: G325D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000070506
Gene: ENSMUSG00000053333
AA Change: G325D

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
RNB	369	719	8.9e-140	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168237
AA Change: G339D

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000132673
Gene: ENSMUSG00000053333
AA Change: G339D

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
RNB	383	733	8.9e-140	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189044

Predicted Effect

probably benign
Transcript: ENSMUST00000190618

SMART Domains

Protein: ENSMUSP00000139579
Gene: ENSMUSG00000053333

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
PDB:2VNU\|D	50	123	4e-10	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192464

Meta Mutation Damage Score

0.2929

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,253,988	W238R	probably damaging	Het
4932416K20Rik	G	A	8: 104,797,639		noncoding transcript	Het
Abcg8	A	T	17: 84,686,699	E48V	probably damaging	Het
Afap1l2	T	C	19: 56,922,974	T289A	probably benign	Het
Atf6	T	A	1: 170,747,189	D560V	probably damaging	Het
Bcl2l14	A	T	6: 134,427,399	K183N	probably damaging	Het
Carmil3	T	C	14: 55,493,239	L52P	probably damaging	Het
Cct3	T	A	3: 88,300,967	N61K	probably damaging	Het
Col18a1	A	G	10: 77,166,343	V10A	unknown	Het
Col26a1	G	A	5: 136,847,566	Q67*	probably null	Het
Cyp2d34	T	C	15: 82,617,140	D329G	probably null	Het
Dchs1	T	A	7: 105,773,040	I58F	probably damaging	Het
Ddx60	T	C	8: 61,948,897	L269P	probably damaging	Het
Dync1h1	A	T	12: 110,646,273	K2861*	probably null	Het
Ednra	A	G	8: 77,675,067	I198T	possibly damaging	Het
Ep300	T	C	15: 81,639,914		probably benign	Het
Fam120a	G	A	13: 48,880,933	P1068S	probably benign	Het
Fsip2	A	T	2: 82,984,740	M3606L	probably benign	Het
Gm7713	T	C	15: 59,994,643		noncoding transcript	Het
Gm9833	A	G	3: 10,088,506	R112G	probably damaging	Het
Gprin3	A	T	6: 59,354,413	V303D	possibly damaging	Het
Hmcn1	A	T	1: 150,694,878	V2178D	possibly damaging	Het
Hoxa11	A	G	6: 52,245,400	V107A	possibly damaging	Het
Iqub	C	A	6: 24,454,251	M544I	possibly damaging	Het
Itgb4	A	T	11: 115,988,432		probably benign	Het
Itpkb	A	G	1: 180,334,253		probably benign	Het
Kalrn	A	T	16: 33,975,820	V1195E	probably damaging	Het
Kif12	C	A	4: 63,165,941	R608M	probably damaging	Het
Lcorl	A	T	5: 45,795,367		probably null	Het
Lrrc24	T	C	15: 76,722,710	E162G	probably damaging	Het
Med6	A	G	12: 81,579,644	S119P	probably damaging	Het
Mmab	A	C	5: 114,436,714	L166R	probably damaging	Het
Nom1	A	G	5: 29,446,875	K737R	possibly damaging	Het
Obscn	T	C	11: 59,056,144	S4352G	probably damaging	Het
Olfr1130	A	T	2: 87,608,173	T262S	probably benign	Het
Olfr1277	A	T	2: 111,269,712	Y218*	probably null	Het
Olfr212	A	C	6: 116,515,951	D58A	possibly damaging	Het
Olfr225	T	A	11: 59,613,886	D307E	probably benign	Het
Pdzrn3	G	A	6: 101,172,314	S351L	probably benign	Het
Pdzrn4	A	T	15: 92,757,681	E485V	probably damaging	Het
Prkdc	T	A	16: 15,779,388	I2804K	possibly damaging	Het
Psg28	A	G	7: 18,430,715	L24P	probably damaging	Het
Resp18	A	G	1: 75,274,000	V145A	possibly damaging	Het
Rgl3	T	C	9: 21,981,612	M259V	probably benign	Het
Rhot2	A	T	17: 25,839,807	S540T	probably benign	Het
Ring1	T	C	17: 34,022,308	Y278C	possibly damaging	Het
Rpn2	A	G	2: 157,295,345	Y216C	probably damaging	Het
Scgb2b18	G	A	7: 33,173,830	L5F	unknown	Het
Slamf7	T	C	1: 171,639,270		probably null	Het
Slc22a12	T	C	19: 6,540,449	N237S	possibly damaging	Het
Spen	A	T	4: 141,478,184	V1044D	unknown	Het
Sqor	A	T	2: 122,809,341	M175L	probably benign	Het
Stx16	G	A	2: 174,093,499	G156R	probably damaging	Het
Tarsl2	T	G	7: 65,684,125	F632V	probably damaging	Het
Tln1	A	G	4: 43,545,191	V1008A	probably benign	Het
Tmem145	A	G	7: 25,315,614	H554R	probably benign	Het
Trank1	A	T	9: 111,366,676	D1256V	possibly damaging	Het
Trbv19	A	G	6: 41,178,860	Y55C	possibly damaging	Het
Ttc23l	C	T	15: 10,551,469	C57Y	probably benign	Het
Uap1	A	T	1: 170,161,380	C158S	probably benign	Het
Zfp353-ps	T	A	8: 42,082,610		noncoding transcript	Het
Zfp629	T	A	7: 127,611,135	I501F	probably damaging	Het
Zfp820	T	C	17: 21,818,721	Y542C	probably damaging	Het

Other mutations in Dis3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Dis3l2	APN	1	86857203	missense	probably benign	0.00
IGL01607:Dis3l2	APN	1	86745487	missense	probably benign	0.04
IGL02233:Dis3l2	APN	1	86990231	missense	probably damaging	1.00
IGL02698:Dis3l2	APN	1	87048829	splice site	probably benign
R0514:Dis3l2	UTSW	1	87047092	missense	probably damaging	1.00
R0893:Dis3l2	UTSW	1	87044206	splice site	probably null
R1086:Dis3l2	UTSW	1	86990149	missense	probably benign	0.36
R1140:Dis3l2	UTSW	1	86821438	missense	probably benign	0.00
R1509:Dis3l2	UTSW	1	87021086	missense	possibly damaging	0.91
R2029:Dis3l2	UTSW	1	86854467	splice site	probably benign
R2511:Dis3l2	UTSW	1	86990258	missense	probably benign	0.05
R3772:Dis3l2	UTSW	1	86854408	missense	probably benign
R4163:Dis3l2	UTSW	1	86821237	missense	probably benign	0.00
R4547:Dis3l2	UTSW	1	87049671	missense	probably benign	0.00
R4548:Dis3l2	UTSW	1	87049671	missense	probably benign	0.00
R4650:Dis3l2	UTSW	1	86990321	missense	possibly damaging	0.83
R4810:Dis3l2	UTSW	1	87047574	missense	probably damaging	0.99
R4936:Dis3l2	UTSW	1	87044168	missense	probably benign	0.00
R5010:Dis3l2	UTSW	1	86760321	missense	probably benign	0.21
R5040:Dis3l2	UTSW	1	86857337	missense	probably damaging	0.98
R5272:Dis3l2	UTSW	1	86973404	missense	possibly damaging	0.72
R5500:Dis3l2	UTSW	1	87021119	critical splice donor site	probably null
R5556:Dis3l2	UTSW	1	86973404	missense	possibly damaging	0.72
R5808:Dis3l2	UTSW	1	87049638	missense	possibly damaging	0.94
R5950:Dis3l2	UTSW	1	87021108	missense	probably damaging	0.96
R6328:Dis3l2	UTSW	1	86854431	missense	probably benign	0.05
R6553:Dis3l2	UTSW	1	86745494	missense	probably damaging	1.00
R6585:Dis3l2	UTSW	1	86745494	missense	probably damaging	1.00
R6905:Dis3l2	UTSW	1	87044839	missense	probably benign	0.00
R6921:Dis3l2	UTSW	1	86857341	missense	probably benign
R7162:Dis3l2	UTSW	1	87044030	missense	possibly damaging	0.94
R7270:Dis3l2	UTSW	1	86990303	missense	possibly damaging	0.49
R7438:Dis3l2	UTSW	1	86745500	critical splice donor site	probably null
R8422:Dis3l2	UTSW	1	86854377	missense	probably benign
R8696:Dis3l2	UTSW	1	86791440	nonsense	probably null
R9235:Dis3l2	UTSW	1	86821339	missense	possibly damaging	0.95
R9291:Dis3l2	UTSW	1	86973493	missense	possibly damaging	0.82
R9629:Dis3l2	UTSW	1	87047062	missense	probably benign	0.00
X0027:Dis3l2	UTSW	1	86760351	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- CTCTGGTCAGAAAATCTCTCCGG -3'
(R):5'- CCCCTAGAAGAAACATCAGGGG -3'

Sequencing Primer
(F):5'- GGTCAGAAAATCTCTCCGGAATGTAC -3'
(R):5'- CCCTAGAAGAAACATCAGGGGAGAAG -3'

Posted On

2016-11-21