Incidental Mutation 'R5772:Tln1'
ID445432
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Nametalin 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5772 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43531519-43562691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43545191 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1008 (V1008A)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187]
PDB Structure
Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
[]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
>> 17 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000030187
AA Change: V1008A

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: V1008A

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125509
SMART Domains Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:IRS 2 28 2e-9 BLAST
PDB:2G35|A 2 29 3e-11 PDB
Pfam:Talin_middle 32 193 1.8e-61 PFAM
PDB:2L7A|A 215 279 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000134623
SMART Domains Protein: ENSMUSP00000119956
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
PDB:1U89|A 2 106 9e-50 PDB
low complexity region 107 120 N/A INTRINSIC
Meta Mutation Damage Score 0.0730 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,253,988 W238R probably damaging Het
4932416K20Rik G A 8: 104,797,639 noncoding transcript Het
Abcg8 A T 17: 84,686,699 E48V probably damaging Het
Afap1l2 T C 19: 56,922,974 T289A probably benign Het
Atf6 T A 1: 170,747,189 D560V probably damaging Het
Bcl2l14 A T 6: 134,427,399 K183N probably damaging Het
Carmil3 T C 14: 55,493,239 L52P probably damaging Het
Cct3 T A 3: 88,300,967 N61K probably damaging Het
Col18a1 A G 10: 77,166,343 V10A unknown Het
Col26a1 G A 5: 136,847,566 Q67* probably null Het
Cyp2d34 T C 15: 82,617,140 D329G probably null Het
Dchs1 T A 7: 105,773,040 I58F probably damaging Het
Ddx60 T C 8: 61,948,897 L269P probably damaging Het
Dis3l2 G A 1: 86,878,432 G325D probably damaging Het
Dync1h1 A T 12: 110,646,273 K2861* probably null Het
Ednra A G 8: 77,675,067 I198T possibly damaging Het
Ep300 T C 15: 81,639,914 probably benign Het
Fam120a G A 13: 48,880,933 P1068S probably benign Het
Fsip2 A T 2: 82,984,740 M3606L probably benign Het
Gm7713 T C 15: 59,994,643 noncoding transcript Het
Gm9833 A G 3: 10,088,506 R112G probably damaging Het
Gprin3 A T 6: 59,354,413 V303D possibly damaging Het
Hmcn1 A T 1: 150,694,878 V2178D possibly damaging Het
Hoxa11 A G 6: 52,245,400 V107A possibly damaging Het
Iqub C A 6: 24,454,251 M544I possibly damaging Het
Itgb4 A T 11: 115,988,432 probably benign Het
Itpkb A G 1: 180,334,253 probably benign Het
Kalrn A T 16: 33,975,820 V1195E probably damaging Het
Kif12 C A 4: 63,165,941 R608M probably damaging Het
Lcorl A T 5: 45,795,367 probably null Het
Lrrc24 T C 15: 76,722,710 E162G probably damaging Het
Med6 A G 12: 81,579,644 S119P probably damaging Het
Mmab A C 5: 114,436,714 L166R probably damaging Het
Nom1 A G 5: 29,446,875 K737R possibly damaging Het
Obscn T C 11: 59,056,144 S4352G probably damaging Het
Olfr1130 A T 2: 87,608,173 T262S probably benign Het
Olfr1277 A T 2: 111,269,712 Y218* probably null Het
Olfr212 A C 6: 116,515,951 D58A possibly damaging Het
Olfr225 T A 11: 59,613,886 D307E probably benign Het
Pdzrn3 G A 6: 101,172,314 S351L probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Prkdc T A 16: 15,779,388 I2804K possibly damaging Het
Psg28 A G 7: 18,430,715 L24P probably damaging Het
Resp18 A G 1: 75,274,000 V145A possibly damaging Het
Rgl3 T C 9: 21,981,612 M259V probably benign Het
Rhot2 A T 17: 25,839,807 S540T probably benign Het
Ring1 T C 17: 34,022,308 Y278C possibly damaging Het
Rpn2 A G 2: 157,295,345 Y216C probably damaging Het
Scgb2b18 G A 7: 33,173,830 L5F unknown Het
Slamf7 T C 1: 171,639,270 probably null Het
Slc22a12 T C 19: 6,540,449 N237S possibly damaging Het
Spen A T 4: 141,478,184 V1044D unknown Het
Sqor A T 2: 122,809,341 M175L probably benign Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tarsl2 T G 7: 65,684,125 F632V probably damaging Het
Tmem145 A G 7: 25,315,614 H554R probably benign Het
Trank1 A T 9: 111,366,676 D1256V possibly damaging Het
Trbv19 A G 6: 41,178,860 Y55C possibly damaging Het
Ttc23l C T 15: 10,551,469 C57Y probably benign Het
Uap1 A T 1: 170,161,380 C158S probably benign Het
Zfp353-ps T A 8: 42,082,610 noncoding transcript Het
Zfp629 T A 7: 127,611,135 I501F probably damaging Het
Zfp820 T C 17: 21,818,721 Y542C probably damaging Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43542719 missense probably benign 0.22
IGL00987:Tln1 APN 4 43551297 unclassified probably benign
IGL01345:Tln1 APN 4 43536281 missense probably damaging 1.00
IGL01456:Tln1 APN 4 43543432 unclassified probably benign
IGL01715:Tln1 APN 4 43555890 missense probably damaging 1.00
IGL01750:Tln1 APN 4 43545435 missense probably damaging 1.00
IGL01933:Tln1 APN 4 43539508 missense probably benign
IGL01933:Tln1 APN 4 43555894 missense possibly damaging 0.52
IGL02119:Tln1 APN 4 43546760 missense probably damaging 0.99
IGL02148:Tln1 APN 4 43555388 missense probably damaging 1.00
IGL02153:Tln1 APN 4 43546857 missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43540612 missense probably benign 0.07
IGL02691:Tln1 APN 4 43539544 missense probably benign 0.42
IGL02882:Tln1 APN 4 43539522 missense probably benign 0.45
IGL02892:Tln1 APN 4 43555679 missense probably damaging 1.00
IGL03061:Tln1 APN 4 43545694 missense probably damaging 1.00
IGL03102:Tln1 APN 4 43532861 missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43539084 splice site probably benign
H8786:Tln1 UTSW 4 43544589 missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43539998 missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43542701 critical splice donor site probably null
R0206:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0208:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0454:Tln1 UTSW 4 43553504 missense probably benign
R0539:Tln1 UTSW 4 43543434 critical splice donor site probably null
R0548:Tln1 UTSW 4 43542709 missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43550304 missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43547756 missense probably benign 0.34
R0607:Tln1 UTSW 4 43553071 missense probably damaging 1.00
R0609:Tln1 UTSW 4 43544645 missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43555333 missense probably damaging 1.00
R0993:Tln1 UTSW 4 43549825 missense probably benign 0.22
R1255:Tln1 UTSW 4 43538044 missense probably damaging 1.00
R1292:Tln1 UTSW 4 43534578 critical splice donor site probably null
R1752:Tln1 UTSW 4 43536311 missense probably damaging 1.00
R2169:Tln1 UTSW 4 43548005 missense probably damaging 1.00
R2172:Tln1 UTSW 4 43545721 missense probably benign
R2202:Tln1 UTSW 4 43553083 unclassified probably null
R2680:Tln1 UTSW 4 43539668 missense probably damaging 1.00
R3012:Tln1 UTSW 4 43542525 missense probably benign
R3714:Tln1 UTSW 4 43540597 missense probably damaging 1.00
R3735:Tln1 UTSW 4 43549370 missense probably damaging 0.97
R3794:Tln1 UTSW 4 43536295 missense probably damaging 1.00
R3825:Tln1 UTSW 4 43536413 splice site probably benign
R3983:Tln1 UTSW 4 43553030 missense probably damaging 1.00
R4061:Tln1 UTSW 4 43549177 missense probably damaging 1.00
R4249:Tln1 UTSW 4 43536104 missense probably damaging 1.00
R4287:Tln1 UTSW 4 43543509 missense probably benign 0.01
R4471:Tln1 UTSW 4 43551018 missense probably benign 0.03
R4562:Tln1 UTSW 4 43533598 missense probably damaging 1.00
R4654:Tln1 UTSW 4 43535954 missense probably null 1.00
R4737:Tln1 UTSW 4 43540588 missense probably benign 0.00
R4936:Tln1 UTSW 4 43547522 missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43539406 missense probably benign 0.06
R5288:Tln1 UTSW 4 43540661 missense probably benign 0.06
R5421:Tln1 UTSW 4 43533609 missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43543905 missense probably benign 0.26
R5660:Tln1 UTSW 4 43547732 missense probably damaging 1.00
R6012:Tln1 UTSW 4 43539508 missense probably benign
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6052:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6145:Tln1 UTSW 4 43538030 missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43534744 missense probably benign 0.06
R6242:Tln1 UTSW 4 43533145 missense probably damaging 1.00
R6454:Tln1 UTSW 4 43533866 missense probably damaging 0.99
R6467:Tln1 UTSW 4 43543165 missense probably benign 0.42
R6548:Tln1 UTSW 4 43547525 missense probably damaging 0.98
R6576:Tln1 UTSW 4 43555419 splice site probably null
R6722:Tln1 UTSW 4 43547618 missense probably damaging 1.00
R6968:Tln1 UTSW 4 43550217 missense probably benign 0.02
R7000:Tln1 UTSW 4 43556302 missense probably damaging 0.96
R7137:Tln1 UTSW 4 43540616 missense probably damaging 1.00
R7242:Tln1 UTSW 4 43542602 missense probably benign 0.01
R7294:Tln1 UTSW 4 43534399 missense probably benign 0.02
R7312:Tln1 UTSW 4 43545922 missense probably damaging 1.00
R7547:Tln1 UTSW 4 43545206 missense possibly damaging 0.80
RF021:Tln1 UTSW 4 43555890 missense probably damaging 1.00
X0052:Tln1 UTSW 4 43533125 critical splice donor site probably null
X0063:Tln1 UTSW 4 43548015 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGGTCCACATGCCTCCTG -3'
(R):5'- CCATGACCTTAAATTTCCCAGTCTG -3'

Sequencing Primer
(F):5'- AGGTTACAGTCCTCCGTCTTAGAG -3'
(R):5'- CTGAATATCTGCTATTAGCCAAGACC -3'
Posted On2016-11-21