Incidental Mutation 'R5772:Hoxa11'
ID445441
Institutional Source Beutler Lab
Gene Symbol Hoxa11
Ensembl Gene ENSMUSG00000038210
Gene Namehomeobox A11
SynonymsHoxa-11, Hox-1.9
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R5772 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location52242106-52245810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52245400 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 107 (V107A)
Ref Sequence ENSEMBL: ENSMUSP00000040920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048026] [ENSMUST00000121043]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048026
AA Change: V107A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040920
Gene: ENSMUSG00000038210
AA Change: V107A

DomainStartEndE-ValueType
Pfam:DUF3528 26 168 4.7e-67 PFAM
low complexity region 172 226 N/A INTRINSIC
HOX 241 303 9.56e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121043
SMART Domains Protein: ENSMUSP00000112872
Gene: ENSMUSG00000000938

DomainStartEndE-ValueType
HOX 20 82 1.15e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184302
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: This gene is located in a cluster of developmentally and temporally regulated genes on chromosome 6 encoding proteins involved in pattern formation. These proteins contain a characteristic DNA-binding motif called a homeodomain and function in transcriptional regulation. There are four distinct clusters of related genes on chromosomes 2, 6, 11, and 15. The protein encoded by this gene is important in the development of the skeleton, limbs, and urogenital tract. Expression of this gene may be regulated by overlapping transcription from an adjacent locus on the opposite strand (GeneID: 15397). [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit homeotic transformations affecting thoracic and sacral vertebrae, and forelimb defects. Mutants are sterile due to malformed vas deferens and cryptorchism in males, and defective uteri in females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,253,988 W238R probably damaging Het
4932416K20Rik G A 8: 104,797,639 noncoding transcript Het
Abcg8 A T 17: 84,686,699 E48V probably damaging Het
Afap1l2 T C 19: 56,922,974 T289A probably benign Het
Atf6 T A 1: 170,747,189 D560V probably damaging Het
Bcl2l14 A T 6: 134,427,399 K183N probably damaging Het
Carmil3 T C 14: 55,493,239 L52P probably damaging Het
Cct3 T A 3: 88,300,967 N61K probably damaging Het
Col18a1 A G 10: 77,166,343 V10A unknown Het
Col26a1 G A 5: 136,847,566 Q67* probably null Het
Cyp2d34 T C 15: 82,617,140 D329G probably null Het
Dchs1 T A 7: 105,773,040 I58F probably damaging Het
Ddx60 T C 8: 61,948,897 L269P probably damaging Het
Dis3l2 G A 1: 86,878,432 G325D probably damaging Het
Dync1h1 A T 12: 110,646,273 K2861* probably null Het
Ednra A G 8: 77,675,067 I198T possibly damaging Het
Ep300 T C 15: 81,639,914 probably benign Het
Fam120a G A 13: 48,880,933 P1068S probably benign Het
Fsip2 A T 2: 82,984,740 M3606L probably benign Het
Gm7713 T C 15: 59,994,643 noncoding transcript Het
Gm9833 A G 3: 10,088,506 R112G probably damaging Het
Gprin3 A T 6: 59,354,413 V303D possibly damaging Het
Hmcn1 A T 1: 150,694,878 V2178D possibly damaging Het
Iqub C A 6: 24,454,251 M544I possibly damaging Het
Itgb4 A T 11: 115,988,432 probably benign Het
Itpkb A G 1: 180,334,253 probably benign Het
Kalrn A T 16: 33,975,820 V1195E probably damaging Het
Kif12 C A 4: 63,165,941 R608M probably damaging Het
Lcorl A T 5: 45,795,367 probably null Het
Lrrc24 T C 15: 76,722,710 E162G probably damaging Het
Med6 A G 12: 81,579,644 S119P probably damaging Het
Mmab A C 5: 114,436,714 L166R probably damaging Het
Nom1 A G 5: 29,446,875 K737R possibly damaging Het
Obscn T C 11: 59,056,144 S4352G probably damaging Het
Olfr1130 A T 2: 87,608,173 T262S probably benign Het
Olfr1277 A T 2: 111,269,712 Y218* probably null Het
Olfr212 A C 6: 116,515,951 D58A possibly damaging Het
Olfr225 T A 11: 59,613,886 D307E probably benign Het
Pdzrn3 G A 6: 101,172,314 S351L probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Prkdc T A 16: 15,779,388 I2804K possibly damaging Het
Psg28 A G 7: 18,430,715 L24P probably damaging Het
Resp18 A G 1: 75,274,000 V145A possibly damaging Het
Rgl3 T C 9: 21,981,612 M259V probably benign Het
Rhot2 A T 17: 25,839,807 S540T probably benign Het
Ring1 T C 17: 34,022,308 Y278C possibly damaging Het
Rpn2 A G 2: 157,295,345 Y216C probably damaging Het
Scgb2b18 G A 7: 33,173,830 L5F unknown Het
Slamf7 T C 1: 171,639,270 probably null Het
Slc22a12 T C 19: 6,540,449 N237S possibly damaging Het
Spen A T 4: 141,478,184 V1044D unknown Het
Sqor A T 2: 122,809,341 M175L probably benign Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tarsl2 T G 7: 65,684,125 F632V probably damaging Het
Tln1 A G 4: 43,545,191 V1008A probably benign Het
Tmem145 A G 7: 25,315,614 H554R probably benign Het
Trank1 A T 9: 111,366,676 D1256V possibly damaging Het
Trbv19 A G 6: 41,178,860 Y55C possibly damaging Het
Ttc23l C T 15: 10,551,469 C57Y probably benign Het
Uap1 A T 1: 170,161,380 C158S probably benign Het
Zfp353-ps T A 8: 42,082,610 noncoding transcript Het
Zfp629 T A 7: 127,611,135 I501F probably damaging Het
Zfp820 T C 17: 21,818,721 Y542C probably damaging Het
Other mutations in Hoxa11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02113:Hoxa11 APN 6 52245317 missense probably damaging 1.00
R1483:Hoxa11 UTSW 6 52243456 missense probably damaging 1.00
R4077:Hoxa11 UTSW 6 52245524 missense probably damaging 1.00
R4665:Hoxa11 UTSW 6 52243503 missense probably damaging 1.00
R6195:Hoxa11 UTSW 6 52245701 missense probably damaging 1.00
R7593:Hoxa11 UTSW 6 52243544 missense probably damaging 1.00
R7681:Hoxa11 UTSW 6 52245119 missense probably benign
R7732:Hoxa11 UTSW 6 52243435 missense probably damaging 1.00
R8508:Hoxa11 UTSW 6 52245802 unclassified probably benign
Z1177:Hoxa11 UTSW 6 52245110 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTTCATAAAGCGCTGGGC -3'
(R):5'- TCGCGCCCAATGACATACTC -3'

Sequencing Primer
(F):5'- TCCGAACTTGAAGTTGCCG -3'
(R):5'- GACATACTCCTACTCCTCCAACCTG -3'
Posted On2016-11-21