Incidental Mutation 'R5772:Tmem145'
ID445447
Institutional Source Beutler Lab
Gene Symbol Tmem145
Ensembl Gene ENSMUSG00000043843
Gene Nametransmembrane protein 145
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5772 (G1)
Quality Score198
Status Validated
Chromosome7
Chromosomal Location25306106-25316195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25315614 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 554 (H554R)
Ref Sequence ENSEMBL: ENSMUSP00000104046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108409] [ENSMUST00000119703] [ENSMUST00000128119]
Predicted Effect probably benign
Transcript: ENSMUST00000108409
AA Change: H554R

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104046
Gene: ENSMUSG00000043843
AA Change: H554R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:GpcrRhopsn4 157 411 7.5e-81 PFAM
low complexity region 486 503 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119703
SMART Domains Protein: ENSMUSP00000112676
Gene: ENSMUSG00000043843

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:GpcrRhopsn4 143 397 4.3e-81 PFAM
low complexity region 478 493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128119
SMART Domains Protein: ENSMUSP00000122192
Gene: ENSMUSG00000045039

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CUB 33 140 1.24e-15 SMART
EGF 141 170 4.26e0 SMART
EGF 173 203 2.43e1 SMART
Pfam:Kelch_4 227 277 1.3e-11 PFAM
Pfam:Kelch_3 240 287 1.6e-7 PFAM
low complexity region 320 341 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 728 738 N/A INTRINSIC
PSI 847 899 1.37e0 SMART
low complexity region 932 938 N/A INTRINSIC
PSI 949 991 2.11e-2 SMART
PSI 1005 1073 7.82e-1 SMART
EGF_CA 1074 1115 2.62e-9 SMART
EGF 1117 1160 5.4e-2 SMART
EGF_like 1163 1208 4e-1 SMART
EGF_Lam 1211 1259 1.03e-7 SMART
Blast:CUB 1263 1401 1e-30 BLAST
EGF_like 1406 1445 3.29e1 SMART
Pfam:Kelch_4 1509 1564 6.5e-12 PFAM
Pfam:Kelch_3 1520 1574 1.2e-10 PFAM
PSI 1868 1923 2.75e-1 SMART
PSI 2004 2062 1.6e0 SMART
PSI 2064 2121 1.68e-5 SMART
EGF 2125 2164 1.08e-1 SMART
EGF 2166 2194 4.26e0 SMART
EGF 2204 2244 2.2e1 SMART
EGF_like 2248 2321 6.37e-1 SMART
low complexity region 2493 2504 N/A INTRINSIC
low complexity region 2530 2541 N/A INTRINSIC
transmembrane domain 2592 2614 N/A INTRINSIC
low complexity region 2649 2668 N/A INTRINSIC
low complexity region 2674 2702 N/A INTRINSIC
low complexity region 2759 2774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205639
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit progressive hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,253,988 W238R probably damaging Het
4932416K20Rik G A 8: 104,797,639 noncoding transcript Het
Abcg8 A T 17: 84,686,699 E48V probably damaging Het
Afap1l2 T C 19: 56,922,974 T289A probably benign Het
Atf6 T A 1: 170,747,189 D560V probably damaging Het
Bcl2l14 A T 6: 134,427,399 K183N probably damaging Het
Carmil3 T C 14: 55,493,239 L52P probably damaging Het
Cct3 T A 3: 88,300,967 N61K probably damaging Het
Col18a1 A G 10: 77,166,343 V10A unknown Het
Col26a1 G A 5: 136,847,566 Q67* probably null Het
Cyp2d34 T C 15: 82,617,140 D329G probably null Het
Dchs1 T A 7: 105,773,040 I58F probably damaging Het
Ddx60 T C 8: 61,948,897 L269P probably damaging Het
Dis3l2 G A 1: 86,878,432 G325D probably damaging Het
Dync1h1 A T 12: 110,646,273 K2861* probably null Het
Ednra A G 8: 77,675,067 I198T possibly damaging Het
Ep300 T C 15: 81,639,914 probably benign Het
Fam120a G A 13: 48,880,933 P1068S probably benign Het
Fsip2 A T 2: 82,984,740 M3606L probably benign Het
Gm7713 T C 15: 59,994,643 noncoding transcript Het
Gm9833 A G 3: 10,088,506 R112G probably damaging Het
Gprin3 A T 6: 59,354,413 V303D possibly damaging Het
Hmcn1 A T 1: 150,694,878 V2178D possibly damaging Het
Hoxa11 A G 6: 52,245,400 V107A possibly damaging Het
Iqub C A 6: 24,454,251 M544I possibly damaging Het
Itgb4 A T 11: 115,988,432 probably benign Het
Itpkb A G 1: 180,334,253 probably benign Het
Kalrn A T 16: 33,975,820 V1195E probably damaging Het
Kif12 C A 4: 63,165,941 R608M probably damaging Het
Lcorl A T 5: 45,795,367 probably null Het
Lrrc24 T C 15: 76,722,710 E162G probably damaging Het
Med6 A G 12: 81,579,644 S119P probably damaging Het
Mmab A C 5: 114,436,714 L166R probably damaging Het
Nom1 A G 5: 29,446,875 K737R possibly damaging Het
Obscn T C 11: 59,056,144 S4352G probably damaging Het
Olfr1130 A T 2: 87,608,173 T262S probably benign Het
Olfr1277 A T 2: 111,269,712 Y218* probably null Het
Olfr212 A C 6: 116,515,951 D58A possibly damaging Het
Olfr225 T A 11: 59,613,886 D307E probably benign Het
Pdzrn3 G A 6: 101,172,314 S351L probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Prkdc T A 16: 15,779,388 I2804K possibly damaging Het
Psg28 A G 7: 18,430,715 L24P probably damaging Het
Resp18 A G 1: 75,274,000 V145A possibly damaging Het
Rgl3 T C 9: 21,981,612 M259V probably benign Het
Rhot2 A T 17: 25,839,807 S540T probably benign Het
Ring1 T C 17: 34,022,308 Y278C possibly damaging Het
Rpn2 A G 2: 157,295,345 Y216C probably damaging Het
Scgb2b18 G A 7: 33,173,830 L5F unknown Het
Slamf7 T C 1: 171,639,270 probably null Het
Slc22a12 T C 19: 6,540,449 N237S possibly damaging Het
Spen A T 4: 141,478,184 V1044D unknown Het
Sqor A T 2: 122,809,341 M175L probably benign Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tarsl2 T G 7: 65,684,125 F632V probably damaging Het
Tln1 A G 4: 43,545,191 V1008A probably benign Het
Trank1 A T 9: 111,366,676 D1256V possibly damaging Het
Trbv19 A G 6: 41,178,860 Y55C possibly damaging Het
Ttc23l C T 15: 10,551,469 C57Y probably benign Het
Uap1 A T 1: 170,161,380 C158S probably benign Het
Zfp353-ps T A 8: 42,082,610 noncoding transcript Het
Zfp629 T A 7: 127,611,135 I501F probably damaging Het
Zfp820 T C 17: 21,818,721 Y542C probably damaging Het
Other mutations in Tmem145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Tmem145 APN 7 25314730 missense possibly damaging 0.88
IGL00958:Tmem145 APN 7 25307357 critical splice donor site probably null
IGL01347:Tmem145 APN 7 25314835 missense probably damaging 0.97
IGL01936:Tmem145 APN 7 25311391 missense probably damaging 0.97
IGL02526:Tmem145 APN 7 25308232 missense probably benign 0.20
IGL02686:Tmem145 APN 7 25314725 missense probably damaging 1.00
IGL03182:Tmem145 APN 7 25314879 missense probably damaging 1.00
R0087:Tmem145 UTSW 7 25307843 missense probably damaging 1.00
R0180:Tmem145 UTSW 7 25314699 missense probably benign 0.05
R0329:Tmem145 UTSW 7 25308674 splice site probably benign
R0504:Tmem145 UTSW 7 25311362 missense probably damaging 1.00
R1488:Tmem145 UTSW 7 25307435 splice site probably null
R1681:Tmem145 UTSW 7 25314734 missense possibly damaging 0.95
R2352:Tmem145 UTSW 7 25306173 missense probably benign
R3834:Tmem145 UTSW 7 25311361 missense probably damaging 1.00
R4175:Tmem145 UTSW 7 25308793 missense probably benign 0.04
R4414:Tmem145 UTSW 7 25307129 missense probably damaging 1.00
R4485:Tmem145 UTSW 7 25307162 missense possibly damaging 0.76
R4631:Tmem145 UTSW 7 25307825 missense probably benign 0.00
R4983:Tmem145 UTSW 7 25308602 missense probably benign 0.03
R4999:Tmem145 UTSW 7 25309034 missense probably benign 0.04
R5821:Tmem145 UTSW 7 25315521 missense probably benign 0.30
R5909:Tmem145 UTSW 7 25308193 missense possibly damaging 0.89
R6021:Tmem145 UTSW 7 25308845 splice site probably null
R6430:Tmem145 UTSW 7 25309038 missense possibly damaging 0.84
R6768:Tmem145 UTSW 7 25308636 missense probably damaging 1.00
R6778:Tmem145 UTSW 7 25311376 missense probably benign 0.04
R7428:Tmem145 UTSW 7 25307165 critical splice donor site probably null
R7536:Tmem145 UTSW 7 25307869 missense probably damaging 1.00
R7748:Tmem145 UTSW 7 25307328 nonsense probably null
R7826:Tmem145 UTSW 7 25307514 missense probably damaging 1.00
R8253:Tmem145 UTSW 7 25307514 missense probably damaging 1.00
R8441:Tmem145 UTSW 7 25308775 missense possibly damaging 0.62
Z1177:Tmem145 UTSW 7 25309646 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAAGTGCGTCCATATTTGG -3'
(R):5'- TCCAGATTCCGGAGCCATTC -3'

Sequencing Primer
(F):5'- TTCTGGGCAGCCTCTGAC -3'
(R):5'- GGACGCAGCGCATCCAAAG -3'
Posted On2016-11-21