Incidental Mutation 'R5772:Col18a1'
ID445458
Institutional Source Beutler Lab
Gene Symbol Col18a1
Ensembl Gene ENSMUSG00000001435
Gene Namecollagen, type XVIII, alpha 1
Synonymsendostatin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5772 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location77052178-77166548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77166343 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 10 (V10A)
Ref Sequence ENSEMBL: ENSMUSP00000080358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081654]
Predicted Effect unknown
Transcript: ENSMUST00000081654
AA Change: V10A
SMART Domains Protein: ENSMUSP00000080358
Gene: ENSMUSG00000001435
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
TSPN 33 221 4.25e-72 SMART
LamG 82 220 2.17e-2 SMART
low complexity region 240 256 N/A INTRINSIC
low complexity region 260 275 N/A INTRINSIC
low complexity region 280 292 N/A INTRINSIC
Pfam:Collagen 359 422 1.6e-10 PFAM
low complexity region 462 483 N/A INTRINSIC
Pfam:Collagen 492 549 1.6e-9 PFAM
Pfam:Collagen 529 594 3.3e-8 PFAM
Pfam:Collagen 601 658 1.9e-9 PFAM
Pfam:Collagen 631 689 4e-8 PFAM
Pfam:Collagen 701 752 1.7e-7 PFAM
Pfam:Collagen 748 808 2.2e-9 PFAM
low complexity region 816 829 N/A INTRINSIC
low complexity region 842 860 N/A INTRINSIC
low complexity region 899 934 N/A INTRINSIC
low complexity region 938 955 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 982 995 N/A INTRINSIC
Pfam:Endostatin 999 1315 8.2e-151 PFAM
Meta Mutation Damage Score 0.0859 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XVIII collagen. This collagen is one of the multiplexins, extracellular matrix proteins that contain multiple triple-helix domains (collagenous domains) interrupted by non-collagenous domains. A long isoform of the protein has an N-terminal domain that is homologous to the extracellular part of frizzled receptors. Proteolytic processing at several endogenous cleavage sites in the C-terminal domain results in production of endostatin, a potent antiangiogenic protein that is able to inhibit angiogenesis and tumor growth. Mutations in this gene are associated with Knobloch syndrome. The main features of this syndrome involve retinal abnormalities, so type XVIII collagen may play an important role in retinal structure and in neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in hyaloid vessel regression, attenuated visual function, abnormal electroretinograms, broad proximal tubule basement membrane, podocyte effacement, and softened glomeruli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,253,988 W238R probably damaging Het
4932416K20Rik G A 8: 104,797,639 noncoding transcript Het
Abcg8 A T 17: 84,686,699 E48V probably damaging Het
Afap1l2 T C 19: 56,922,974 T289A probably benign Het
Atf6 T A 1: 170,747,189 D560V probably damaging Het
Bcl2l14 A T 6: 134,427,399 K183N probably damaging Het
Carmil3 T C 14: 55,493,239 L52P probably damaging Het
Cct3 T A 3: 88,300,967 N61K probably damaging Het
Col26a1 G A 5: 136,847,566 Q67* probably null Het
Cyp2d34 T C 15: 82,617,140 D329G probably null Het
Dchs1 T A 7: 105,773,040 I58F probably damaging Het
Ddx60 T C 8: 61,948,897 L269P probably damaging Het
Dis3l2 G A 1: 86,878,432 G325D probably damaging Het
Dync1h1 A T 12: 110,646,273 K2861* probably null Het
Ednra A G 8: 77,675,067 I198T possibly damaging Het
Ep300 T C 15: 81,639,914 probably benign Het
Fam120a G A 13: 48,880,933 P1068S probably benign Het
Fsip2 A T 2: 82,984,740 M3606L probably benign Het
Gm7713 T C 15: 59,994,643 noncoding transcript Het
Gm9833 A G 3: 10,088,506 R112G probably damaging Het
Gprin3 A T 6: 59,354,413 V303D possibly damaging Het
Hmcn1 A T 1: 150,694,878 V2178D possibly damaging Het
Hoxa11 A G 6: 52,245,400 V107A possibly damaging Het
Iqub C A 6: 24,454,251 M544I possibly damaging Het
Itgb4 A T 11: 115,988,432 probably benign Het
Itpkb A G 1: 180,334,253 probably benign Het
Kalrn A T 16: 33,975,820 V1195E probably damaging Het
Kif12 C A 4: 63,165,941 R608M probably damaging Het
Lcorl A T 5: 45,795,367 probably null Het
Lrrc24 T C 15: 76,722,710 E162G probably damaging Het
Med6 A G 12: 81,579,644 S119P probably damaging Het
Mmab A C 5: 114,436,714 L166R probably damaging Het
Nom1 A G 5: 29,446,875 K737R possibly damaging Het
Obscn T C 11: 59,056,144 S4352G probably damaging Het
Olfr1130 A T 2: 87,608,173 T262S probably benign Het
Olfr1277 A T 2: 111,269,712 Y218* probably null Het
Olfr212 A C 6: 116,515,951 D58A possibly damaging Het
Olfr225 T A 11: 59,613,886 D307E probably benign Het
Pdzrn3 G A 6: 101,172,314 S351L probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Prkdc T A 16: 15,779,388 I2804K possibly damaging Het
Psg28 A G 7: 18,430,715 L24P probably damaging Het
Resp18 A G 1: 75,274,000 V145A possibly damaging Het
Rgl3 T C 9: 21,981,612 M259V probably benign Het
Rhot2 A T 17: 25,839,807 S540T probably benign Het
Ring1 T C 17: 34,022,308 Y278C possibly damaging Het
Rpn2 A G 2: 157,295,345 Y216C probably damaging Het
Scgb2b18 G A 7: 33,173,830 L5F unknown Het
Slamf7 T C 1: 171,639,270 probably null Het
Slc22a12 T C 19: 6,540,449 N237S possibly damaging Het
Spen A T 4: 141,478,184 V1044D unknown Het
Sqor A T 2: 122,809,341 M175L probably benign Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tarsl2 T G 7: 65,684,125 F632V probably damaging Het
Tln1 A G 4: 43,545,191 V1008A probably benign Het
Tmem145 A G 7: 25,315,614 H554R probably benign Het
Trank1 A T 9: 111,366,676 D1256V possibly damaging Het
Trbv19 A G 6: 41,178,860 Y55C possibly damaging Het
Ttc23l C T 15: 10,551,469 C57Y probably benign Het
Uap1 A T 1: 170,161,380 C158S probably benign Het
Zfp353-ps T A 8: 42,082,610 noncoding transcript Het
Zfp629 T A 7: 127,611,135 I501F probably damaging Het
Zfp820 T C 17: 21,818,721 Y542C probably damaging Het
Other mutations in Col18a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Col18a1 APN 10 77069979 missense possibly damaging 0.93
IGL01023:Col18a1 APN 10 77070975 missense probably damaging 0.98
IGL01304:Col18a1 APN 10 77076141 unclassified probably benign
IGL01519:Col18a1 APN 10 77059323 missense probably damaging 0.99
IGL02217:Col18a1 APN 10 77053298 missense probably damaging 0.96
IGL02275:Col18a1 APN 10 77059383 missense possibly damaging 0.92
IGL02283:Col18a1 APN 10 77113109 missense possibly damaging 0.71
IGL02492:Col18a1 APN 10 77072021 splice site probably benign
IGL02673:Col18a1 APN 10 77059163 missense probably damaging 1.00
IGL02710:Col18a1 APN 10 77113312 missense possibly damaging 0.92
IGL02850:Col18a1 APN 10 77096466 missense probably damaging 0.98
IGL03085:Col18a1 APN 10 77059181 splice site probably benign
IGL03102:Col18a1 APN 10 77067623 splice site probably benign
IGL03139:Col18a1 APN 10 77113343 missense possibly damaging 0.84
IGL03181:Col18a1 APN 10 77055698 missense probably damaging 1.00
IGL03183:Col18a1 APN 10 77073754 missense probably damaging 1.00
R0039:Col18a1 UTSW 10 77077168 missense probably damaging 1.00
R0180:Col18a1 UTSW 10 77096517 missense probably benign 0.33
R0225:Col18a1 UTSW 10 77088914 missense possibly damaging 0.90
R0335:Col18a1 UTSW 10 77059363 missense probably damaging 0.99
R0336:Col18a1 UTSW 10 77058736 missense probably damaging 1.00
R1471:Col18a1 UTSW 10 77096206 missense unknown
R1538:Col18a1 UTSW 10 77071336 missense probably damaging 1.00
R1594:Col18a1 UTSW 10 77113036 missense possibly damaging 0.51
R1631:Col18a1 UTSW 10 77059297 missense probably damaging 0.99
R1774:Col18a1 UTSW 10 77059981 missense probably damaging 0.96
R1934:Col18a1 UTSW 10 77112744 missense possibly damaging 0.73
R1990:Col18a1 UTSW 10 77081154 missense unknown
R1991:Col18a1 UTSW 10 77081154 missense unknown
R1992:Col18a1 UTSW 10 77081154 missense unknown
R2081:Col18a1 UTSW 10 77054185 missense probably damaging 1.00
R2082:Col18a1 UTSW 10 77059293 missense probably damaging 1.00
R2351:Col18a1 UTSW 10 77112704 missense probably benign 0.00
R2510:Col18a1 UTSW 10 77096268 missense unknown
R3076:Col18a1 UTSW 10 77088928 missense possibly damaging 0.57
R3433:Col18a1 UTSW 10 77096268 missense unknown
R3800:Col18a1 UTSW 10 77067387 nonsense probably null
R3918:Col18a1 UTSW 10 77053358 missense probably benign 0.05
R3981:Col18a1 UTSW 10 77088887 missense probably damaging 0.99
R3983:Col18a1 UTSW 10 77088887 missense probably damaging 0.99
R4182:Col18a1 UTSW 10 77058841 splice site probably null
R4239:Col18a1 UTSW 10 77096167 missense unknown
R5014:Col18a1 UTSW 10 77070960 critical splice donor site probably null
R5107:Col18a1 UTSW 10 77077223 critical splice acceptor site probably null
R5413:Col18a1 UTSW 10 77069476 missense probably damaging 1.00
R5503:Col18a1 UTSW 10 77071620 missense probably damaging 1.00
R5524:Col18a1 UTSW 10 77058724 missense probably damaging 1.00
R5958:Col18a1 UTSW 10 77096397 missense probably benign 0.01
R6280:Col18a1 UTSW 10 77112489 intron probably benign
R6309:Col18a1 UTSW 10 77112742 intron probably benign
R6603:Col18a1 UTSW 10 77063977 critical splice donor site probably null
R6608:Col18a1 UTSW 10 77112794 intron probably benign
R6805:Col18a1 UTSW 10 77054239 missense probably damaging 1.00
R6890:Col18a1 UTSW 10 77113484 intron probably benign
R6938:Col18a1 UTSW 10 77112499 intron probably benign
R7002:Col18a1 UTSW 10 77166343 missense unknown
R7154:Col18a1 UTSW 10 77072965 missense probably benign 0.25
R7204:Col18a1 UTSW 10 77085276 missense unknown
R7278:Col18a1 UTSW 10 77096284 missense unknown
R7442:Col18a1 UTSW 10 77096238 missense unknown
R7453:Col18a1 UTSW 10 77085210 splice site probably null
R7597:Col18a1 UTSW 10 77113303 missense unknown
R7615:Col18a1 UTSW 10 77067005 missense probably damaging 1.00
R7671:Col18a1 UTSW 10 77085383 missense unknown
R7696:Col18a1 UTSW 10 77085272 missense unknown
R7719:Col18a1 UTSW 10 77078012 missense probably benign 0.13
R7772:Col18a1 UTSW 10 77068386 splice site probably null
R8077:Col18a1 UTSW 10 77080851 missense unknown
R8085:Col18a1 UTSW 10 77088907 missense unknown
R8097:Col18a1 UTSW 10 77112508 missense unknown
R8117:Col18a1 UTSW 10 77059974 missense probably benign 0.41
R8130:Col18a1 UTSW 10 77074450 missense probably benign 0.03
R8151:Col18a1 UTSW 10 77112584 missense unknown
R8379:Col18a1 UTSW 10 77053238 missense probably benign 0.08
R8479:Col18a1 UTSW 10 77081154 missense unknown
R8523:Col18a1 UTSW 10 77054234 missense probably damaging 0.99
R8862:Col18a1 UTSW 10 77113210 nonsense probably null
Z1176:Col18a1 UTSW 10 77055709 missense possibly damaging 0.81
Z1176:Col18a1 UTSW 10 77112851 missense unknown
Z1177:Col18a1 UTSW 10 77112838 missense unknown
Predicted Primers PCR Primer
(F):5'- AACCCTAGAGAATGAATGGCC -3'
(R):5'- TCCTACCAGATTGCTCACCG -3'

Sequencing Primer
(F):5'- ACCATCGCGCTACCCTTGAG -3'
(R):5'- AGATTGCTCACCGGGTCCTC -3'
Posted On2016-11-21