Mutagenetix > Incidental Mutation

Incidental Mutation 'R5772:Ep300'

445469

Institutional Source

Beutler Lab

Gene Symbol

Ep300

Ensembl Gene

ENSMUSG00000055024

Gene Name

E1A binding protein p300

Synonyms

KAT3B, p300

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5772 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81585351-81652077 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 81639914 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000066789 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068387]

AlphaFold

B2RWS6

Predicted Effect

probably benign
Transcript: ENSMUST00000068387

SMART Domains

Protein: ENSMUSP00000066789
Gene: ENSMUSG00000055024

Domain	Start	End	E-Value	Type
low complexity region	18	28	N/A	INTRINSIC
low complexity region	162	178	N/A	INTRINSIC
low complexity region	223	242	N/A	INTRINSIC
low complexity region	296	309	N/A	INTRINSIC
ZnF_TAZ	333	418	2.85e-32	SMART
low complexity region	475	488	N/A	INTRINSIC
low complexity region	492	503	N/A	INTRINSIC
Pfam:KIX	567	647	7.2e-44	PFAM
low complexity region	722	735	N/A	INTRINSIC
low complexity region	831	848	N/A	INTRINSIC
low complexity region	852	882	N/A	INTRINSIC
low complexity region	884	920	N/A	INTRINSIC
low complexity region	924	943	N/A	INTRINSIC
low complexity region	1024	1039	N/A	INTRINSIC
BROMO	1047	1157	6.36e-42	SMART
Blast:KAT11	1227	1300	9e-22	BLAST
KAT11	1305	1610	1.19e-140	SMART
ZnF_ZZ	1663	1704	2.67e-15	SMART
ZnF_TAZ	1728	1806	5.53e-30	SMART
low complexity region	1810	1836	N/A	INTRINSIC
low complexity region	1847	1881	N/A	INTRINSIC
low complexity region	1902	1927	N/A	INTRINSIC
low complexity region	1962	1979	N/A	INTRINSIC
Pfam:Creb_binding	1993	2099	3.5e-37	PFAM
low complexity region	2146	2158	N/A	INTRINSIC
low complexity region	2187	2203	N/A	INTRINSIC
low complexity region	2205	2244	N/A	INTRINSIC
low complexity region	2254	2265	N/A	INTRINSIC
low complexity region	2303	2346	N/A	INTRINSIC
low complexity region	2390	2405	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187776

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205816

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206431

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lung, and small intestine and die at midgestation; heterozygotes also show some embryonic loss. Heterozygotes for an acetyltransferase-negative mutation die by the neonatal period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,253,988	W238R	probably damaging	Het
4932416K20Rik	G	A	8: 104,797,639		noncoding transcript	Het
Abcg8	A	T	17: 84,686,699	E48V	probably damaging	Het
Afap1l2	T	C	19: 56,922,974	T289A	probably benign	Het
Atf6	T	A	1: 170,747,189	D560V	probably damaging	Het
Bcl2l14	A	T	6: 134,427,399	K183N	probably damaging	Het
Carmil3	T	C	14: 55,493,239	L52P	probably damaging	Het
Cct3	T	A	3: 88,300,967	N61K	probably damaging	Het
Col18a1	A	G	10: 77,166,343	V10A	unknown	Het
Col26a1	G	A	5: 136,847,566	Q67*	probably null	Het
Cyp2d34	T	C	15: 82,617,140	D329G	probably null	Het
Dchs1	T	A	7: 105,773,040	I58F	probably damaging	Het
Ddx60	T	C	8: 61,948,897	L269P	probably damaging	Het
Dis3l2	G	A	1: 86,878,432	G325D	probably damaging	Het
Dync1h1	A	T	12: 110,646,273	K2861*	probably null	Het
Ednra	A	G	8: 77,675,067	I198T	possibly damaging	Het
Fam120a	G	A	13: 48,880,933	P1068S	probably benign	Het
Fsip2	A	T	2: 82,984,740	M3606L	probably benign	Het
Gm7713	T	C	15: 59,994,643		noncoding transcript	Het
Gm9833	A	G	3: 10,088,506	R112G	probably damaging	Het
Gprin3	A	T	6: 59,354,413	V303D	possibly damaging	Het
Hmcn1	A	T	1: 150,694,878	V2178D	possibly damaging	Het
Hoxa11	A	G	6: 52,245,400	V107A	possibly damaging	Het
Iqub	C	A	6: 24,454,251	M544I	possibly damaging	Het
Itgb4	A	T	11: 115,988,432		probably benign	Het
Itpkb	A	G	1: 180,334,253		probably benign	Het
Kalrn	A	T	16: 33,975,820	V1195E	probably damaging	Het
Kif12	C	A	4: 63,165,941	R608M	probably damaging	Het
Lcorl	A	T	5: 45,795,367		probably null	Het
Lrrc24	T	C	15: 76,722,710	E162G	probably damaging	Het
Med6	A	G	12: 81,579,644	S119P	probably damaging	Het
Mmab	A	C	5: 114,436,714	L166R	probably damaging	Het
Nom1	A	G	5: 29,446,875	K737R	possibly damaging	Het
Obscn	T	C	11: 59,056,144	S4352G	probably damaging	Het
Olfr1130	A	T	2: 87,608,173	T262S	probably benign	Het
Olfr1277	A	T	2: 111,269,712	Y218*	probably null	Het
Olfr212	A	C	6: 116,515,951	D58A	possibly damaging	Het
Olfr225	T	A	11: 59,613,886	D307E	probably benign	Het
Pdzrn3	G	A	6: 101,172,314	S351L	probably benign	Het
Pdzrn4	A	T	15: 92,757,681	E485V	probably damaging	Het
Prkdc	T	A	16: 15,779,388	I2804K	possibly damaging	Het
Psg28	A	G	7: 18,430,715	L24P	probably damaging	Het
Resp18	A	G	1: 75,274,000	V145A	possibly damaging	Het
Rgl3	T	C	9: 21,981,612	M259V	probably benign	Het
Rhot2	A	T	17: 25,839,807	S540T	probably benign	Het
Ring1	T	C	17: 34,022,308	Y278C	possibly damaging	Het
Rpn2	A	G	2: 157,295,345	Y216C	probably damaging	Het
Scgb2b18	G	A	7: 33,173,830	L5F	unknown	Het
Slamf7	T	C	1: 171,639,270		probably null	Het
Slc22a12	T	C	19: 6,540,449	N237S	possibly damaging	Het
Spen	A	T	4: 141,478,184	V1044D	unknown	Het
Sqor	A	T	2: 122,809,341	M175L	probably benign	Het
Stx16	G	A	2: 174,093,499	G156R	probably damaging	Het
Tarsl2	T	G	7: 65,684,125	F632V	probably damaging	Het
Tln1	A	G	4: 43,545,191	V1008A	probably benign	Het
Tmem145	A	G	7: 25,315,614	H554R	probably benign	Het
Trank1	A	T	9: 111,366,676	D1256V	possibly damaging	Het
Trbv19	A	G	6: 41,178,860	Y55C	possibly damaging	Het
Ttc23l	C	T	15: 10,551,469	C57Y	probably benign	Het
Uap1	A	T	1: 170,161,380	C158S	probably benign	Het
Zfp353-ps	T	A	8: 42,082,610		noncoding transcript	Het
Zfp629	T	A	7: 127,611,135	I501F	probably damaging	Het
Zfp820	T	C	17: 21,818,721	Y542C	probably damaging	Het

Other mutations in Ep300

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Ep300	APN	15	81641418	missense	unknown
IGL01128:Ep300	APN	15	81630006	unclassified	probably benign
IGL01151:Ep300	APN	15	81623472	intron	probably benign
IGL01414:Ep300	APN	15	81627266	unclassified	probably benign
IGL01564:Ep300	APN	15	81632464	unclassified	probably benign
IGL01875:Ep300	APN	15	81640023	missense	unknown
IGL01945:Ep300	APN	15	81616109	unclassified	probably benign
IGL02022:Ep300	APN	15	81611437	unclassified	probably benign
IGL02115:Ep300	APN	15	81648818	missense	unknown
IGL02129:Ep300	APN	15	81586636	missense	unknown
IGL02145:Ep300	APN	15	81601166	missense	unknown
IGL02149:Ep300	APN	15	81628420	unclassified	probably benign
IGL02165:Ep300	APN	15	81641391	missense	probably benign	0.39
IGL02226:Ep300	APN	15	81613412	missense	unknown
IGL02610:Ep300	APN	15	81601522	missense	unknown
IGL02731:Ep300	APN	15	81648414	missense	unknown
IGL03239:Ep300	APN	15	81641388	missense	unknown
BB001:Ep300	UTSW	15	81649502	missense	unknown
BB011:Ep300	UTSW	15	81649502	missense	unknown
R0077:Ep300	UTSW	15	81641313	missense	unknown
R0145:Ep300	UTSW	15	81616127	critical splice donor site	probably null
R0244:Ep300	UTSW	15	81640128	missense	unknown
R0390:Ep300	UTSW	15	81640116	missense	unknown
R0534:Ep300	UTSW	15	81600896	splice site	probably benign
R0671:Ep300	UTSW	15	81616134	unclassified	probably benign
R0840:Ep300	UTSW	15	81644933	missense	unknown
R1166:Ep300	UTSW	15	81630064	unclassified	probably benign
R1737:Ep300	UTSW	15	81626347	missense	probably damaging	0.99
R1893:Ep300	UTSW	15	81631646	unclassified	probably benign
R2136:Ep300	UTSW	15	81640447	missense	unknown
R3427:Ep300	UTSW	15	81601279	missense	unknown
R3757:Ep300	UTSW	15	81648589	missense	unknown
R3892:Ep300	UTSW	15	81619997	unclassified	probably benign
R4554:Ep300	UTSW	15	81601430	missense	unknown
R4575:Ep300	UTSW	15	81649009	missense	unknown
R4575:Ep300	UTSW	15	81611410	unclassified	probably benign
R4577:Ep300	UTSW	15	81611410	unclassified	probably benign
R4577:Ep300	UTSW	15	81649009	missense	unknown
R4578:Ep300	UTSW	15	81649009	missense	unknown
R4578:Ep300	UTSW	15	81611410	unclassified	probably benign
R5021:Ep300	UTSW	15	81640023	missense	unknown
R5366:Ep300	UTSW	15	81616100	missense	probably benign	0.24
R5372:Ep300	UTSW	15	81636830	missense	unknown
R5393:Ep300	UTSW	15	81631618	unclassified	probably benign
R5410:Ep300	UTSW	15	81648854	missense	unknown
R5571:Ep300	UTSW	15	81643217	intron	probably benign
R5701:Ep300	UTSW	15	81601495	missense	unknown
R5825:Ep300	UTSW	15	81611472	missense	probably benign	0.39
R5917:Ep300	UTSW	15	81628607	unclassified	probably benign
R5991:Ep300	UTSW	15	81648466	missense	unknown
R6019:Ep300	UTSW	15	81641382	missense	unknown
R6144:Ep300	UTSW	15	81601234	missense	unknown
R6291:Ep300	UTSW	15	81648507	missense	unknown
R6292:Ep300	UTSW	15	81616734	unclassified	probably benign
R6599:Ep300	UTSW	15	81586713	missense	unknown
R6804:Ep300	UTSW	15	81641311	nonsense	probably null
R6925:Ep300	UTSW	15	81649981	missense	probably benign	0.32
R7327:Ep300	UTSW	15	81627314	missense	unknown
R7378:Ep300	UTSW	15	81650545	missense	probably damaging	0.97
R7388:Ep300	UTSW	15	81648366	missense	unknown
R7419:Ep300	UTSW	15	81648514	missense	unknown
R7498:Ep300	UTSW	15	81639843	missense	unknown
R7584:Ep300	UTSW	15	81628426	missense	unknown
R7605:Ep300	UTSW	15	81621152	missense	unknown
R7619:Ep300	UTSW	15	81608198	missense	unknown
R7699:Ep300	UTSW	15	81586393	start gained	probably benign
R7763:Ep300	UTSW	15	81586583	start gained	probably benign
R7775:Ep300	UTSW	15	81586686	missense	unknown
R7778:Ep300	UTSW	15	81586686	missense	unknown
R7862:Ep300	UTSW	15	81650753	missense	probably damaging	1.00
R7924:Ep300	UTSW	15	81649502	missense	unknown
R8155:Ep300	UTSW	15	81621068	missense	unknown
R8259:Ep300	UTSW	15	81639017	missense	unknown
R8276:Ep300	UTSW	15	81650028	missense	possibly damaging	0.85
R8331:Ep300	UTSW	15	81601210	missense	unknown
R8554:Ep300	UTSW	15	81639027	missense	unknown
R9019:Ep300	UTSW	15	81648529	missense	unknown
R9128:Ep300	UTSW	15	81649745	missense	unknown
R9379:Ep300	UTSW	15	81648559	missense	unknown
R9380:Ep300	UTSW	15	81616044	missense	unknown
R9484:Ep300	UTSW	15	81636825	missense	unknown
R9659:Ep300	UTSW	15	81621072	missense	unknown
R9690:Ep300	UTSW	15	81636195	missense	unknown
R9721:Ep300	UTSW	15	81608315	missense	unknown
RF020:Ep300	UTSW	15	81586571	start gained	probably benign
Z1177:Ep300	UTSW	15	81630097	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGCACAAGACCTTAACTTGGTAAC -3'
(R):5'- TGAACATGCATGCCGAAGAAAC -3'

Sequencing Primer
(F):5'- ATTTCTAGGATTGCCATCTACCAGAC -3'
(R):5'- TGCATGCCGAAGAAACACAAGTC -3'

Posted On

2016-11-21