Incidental Mutation 'R5772:Pdzrn4'
ID445471
Institutional Source Beutler Lab
Gene Symbol Pdzrn4
Ensembl Gene ENSMUSG00000036218
Gene NamePDZ domain containing RING finger 4
Synonyms1110017D07Rik, LNX4, SAMCAP3L
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R5772 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location92396881-92771819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92757681 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 485 (E485V)
Ref Sequence ENSEMBL: ENSMUSP00000133159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035399
AA Change: E246V

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: E246V

DomainStartEndE-ValueType
Blast:PDZ 1 56 4e-24 BLAST
SCOP:d1qaua_ 20 61 1e-3 SMART
PDB:1UHP|A 21 64 9e-12 PDB
PDZ 154 229 3.01e-18 SMART
low complexity region 240 259 N/A INTRINSIC
low complexity region 267 278 N/A INTRINSIC
coiled coil region 394 430 N/A INTRINSIC
low complexity region 563 577 N/A INTRINSIC
low complexity region 696 709 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169942
AA Change: E485V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: E485V

DomainStartEndE-ValueType
RING 22 56 1.38e-1 SMART
low complexity region 101 124 N/A INTRINSIC
PDZ 213 295 3.82e-20 SMART
PDZ 393 468 3.01e-18 SMART
low complexity region 479 498 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
coiled coil region 633 669 N/A INTRINSIC
low complexity region 802 816 N/A INTRINSIC
low complexity region 935 948 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
Meta Mutation Damage Score 0.1919 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,253,988 W238R probably damaging Het
4932416K20Rik G A 8: 104,797,639 noncoding transcript Het
Abcg8 A T 17: 84,686,699 E48V probably damaging Het
Afap1l2 T C 19: 56,922,974 T289A probably benign Het
Atf6 T A 1: 170,747,189 D560V probably damaging Het
Bcl2l14 A T 6: 134,427,399 K183N probably damaging Het
Carmil3 T C 14: 55,493,239 L52P probably damaging Het
Cct3 T A 3: 88,300,967 N61K probably damaging Het
Col18a1 A G 10: 77,166,343 V10A unknown Het
Col26a1 G A 5: 136,847,566 Q67* probably null Het
Cyp2d34 T C 15: 82,617,140 D329G probably null Het
Dchs1 T A 7: 105,773,040 I58F probably damaging Het
Ddx60 T C 8: 61,948,897 L269P probably damaging Het
Dis3l2 G A 1: 86,878,432 G325D probably damaging Het
Dync1h1 A T 12: 110,646,273 K2861* probably null Het
Ednra A G 8: 77,675,067 I198T possibly damaging Het
Ep300 T C 15: 81,639,914 probably benign Het
Fam120a G A 13: 48,880,933 P1068S probably benign Het
Fsip2 A T 2: 82,984,740 M3606L probably benign Het
Gm7713 T C 15: 59,994,643 noncoding transcript Het
Gm9833 A G 3: 10,088,506 R112G probably damaging Het
Gprin3 A T 6: 59,354,413 V303D possibly damaging Het
Hmcn1 A T 1: 150,694,878 V2178D possibly damaging Het
Hoxa11 A G 6: 52,245,400 V107A possibly damaging Het
Iqub C A 6: 24,454,251 M544I possibly damaging Het
Itgb4 A T 11: 115,988,432 probably benign Het
Itpkb A G 1: 180,334,253 probably benign Het
Kalrn A T 16: 33,975,820 V1195E probably damaging Het
Kif12 C A 4: 63,165,941 R608M probably damaging Het
Lcorl A T 5: 45,795,367 probably null Het
Lrrc24 T C 15: 76,722,710 E162G probably damaging Het
Med6 A G 12: 81,579,644 S119P probably damaging Het
Mmab A C 5: 114,436,714 L166R probably damaging Het
Nom1 A G 5: 29,446,875 K737R possibly damaging Het
Obscn T C 11: 59,056,144 S4352G probably damaging Het
Olfr1130 A T 2: 87,608,173 T262S probably benign Het
Olfr1277 A T 2: 111,269,712 Y218* probably null Het
Olfr212 A C 6: 116,515,951 D58A possibly damaging Het
Olfr225 T A 11: 59,613,886 D307E probably benign Het
Pdzrn3 G A 6: 101,172,314 S351L probably benign Het
Prkdc T A 16: 15,779,388 I2804K possibly damaging Het
Psg28 A G 7: 18,430,715 L24P probably damaging Het
Resp18 A G 1: 75,274,000 V145A possibly damaging Het
Rgl3 T C 9: 21,981,612 M259V probably benign Het
Rhot2 A T 17: 25,839,807 S540T probably benign Het
Ring1 T C 17: 34,022,308 Y278C possibly damaging Het
Rpn2 A G 2: 157,295,345 Y216C probably damaging Het
Scgb2b18 G A 7: 33,173,830 L5F unknown Het
Slamf7 T C 1: 171,639,270 probably null Het
Slc22a12 T C 19: 6,540,449 N237S possibly damaging Het
Spen A T 4: 141,478,184 V1044D unknown Het
Sqor A T 2: 122,809,341 M175L probably benign Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tarsl2 T G 7: 65,684,125 F632V probably damaging Het
Tln1 A G 4: 43,545,191 V1008A probably benign Het
Tmem145 A G 7: 25,315,614 H554R probably benign Het
Trank1 A T 9: 111,366,676 D1256V possibly damaging Het
Trbv19 A G 6: 41,178,860 Y55C possibly damaging Het
Ttc23l C T 15: 10,551,469 C57Y probably benign Het
Uap1 A T 1: 170,161,380 C158S probably benign Het
Zfp353-ps T A 8: 42,082,610 noncoding transcript Het
Zfp629 T A 7: 127,611,135 I501F probably damaging Het
Zfp820 T C 17: 21,818,721 Y542C probably damaging Het
Other mutations in Pdzrn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Pdzrn4 APN 15 92746278 missense probably damaging 1.00
IGL01991:Pdzrn4 APN 15 92401926 splice site probably null
IGL02103:Pdzrn4 APN 15 92769887 missense probably damaging 1.00
IGL02243:Pdzrn4 APN 15 92770696 missense probably benign 0.30
IGL02269:Pdzrn4 APN 15 92769850 missense probably damaging 1.00
IGL03005:Pdzrn4 APN 15 92770391 missense probably damaging 1.00
PIT4362001:Pdzrn4 UTSW 15 92769881 missense possibly damaging 0.46
R0243:Pdzrn4 UTSW 15 92770319 missense possibly damaging 0.46
R0367:Pdzrn4 UTSW 15 92757657 missense possibly damaging 0.53
R0972:Pdzrn4 UTSW 15 92757711 missense probably benign 0.00
R1168:Pdzrn4 UTSW 15 92770271 missense probably benign 0.16
R1411:Pdzrn4 UTSW 15 92771013 makesense probably null
R1466:Pdzrn4 UTSW 15 92770537 missense probably benign 0.00
R1466:Pdzrn4 UTSW 15 92770537 missense probably benign 0.00
R1489:Pdzrn4 UTSW 15 92677712 missense probably benign
R1503:Pdzrn4 UTSW 15 92399804 missense probably damaging 0.99
R1561:Pdzrn4 UTSW 15 92677637 missense possibly damaging 0.84
R1584:Pdzrn4 UTSW 15 92770537 missense probably benign 0.00
R1733:Pdzrn4 UTSW 15 92401974 missense probably benign 0.06
R1965:Pdzrn4 UTSW 15 92746309 splice site probably null
R2061:Pdzrn4 UTSW 15 92770160 missense probably damaging 0.99
R3010:Pdzrn4 UTSW 15 92769811 missense probably benign 0.32
R4016:Pdzrn4 UTSW 15 92399749 missense probably benign
R4032:Pdzrn4 UTSW 15 92769533 missense probably damaging 1.00
R4110:Pdzrn4 UTSW 15 92770864 missense probably benign 0.26
R4180:Pdzrn4 UTSW 15 92402017 missense possibly damaging 0.93
R4539:Pdzrn4 UTSW 15 92770589 missense probably damaging 1.00
R4617:Pdzrn4 UTSW 15 92769842 missense probably damaging 1.00
R4734:Pdzrn4 UTSW 15 92770252 nonsense probably null
R4900:Pdzrn4 UTSW 15 92770757 missense probably damaging 1.00
R5422:Pdzrn4 UTSW 15 92677621 missense probably benign 0.01
R5444:Pdzrn4 UTSW 15 92770925 missense probably damaging 1.00
R5775:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R5935:Pdzrn4 UTSW 15 92397374 missense probably benign 0.01
R6192:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6210:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6258:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6259:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6391:Pdzrn4 UTSW 15 92680537 missense probably damaging 0.99
R6613:Pdzrn4 UTSW 15 92677574 missense probably damaging 0.99
R7046:Pdzrn4 UTSW 15 92770422 nonsense probably null
R7096:Pdzrn4 UTSW 15 92397503 missense probably benign 0.00
R7451:Pdzrn4 UTSW 15 92770067 missense possibly damaging 0.68
X0018:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0020:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0021:Pdzrn4 UTSW 15 92677709 missense probably damaging 1.00
X0026:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92680512 missense possibly damaging 0.92
X0065:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGTTTCAGGAGAGGATAAAAGGCC -3'
(R):5'- AAGATCGTTTGCCCCGAAAG -3'

Sequencing Primer
(F):5'- CTTCTTTCTGAGAGGTGACCAGAG -3'
(R):5'- CGTTTGCCCCGAAAGATTATG -3'
Posted On2016-11-21