Incidental Mutation 'R5772:Pdzrn4'
ID 445471
Institutional Source Beutler Lab
Gene Symbol Pdzrn4
Ensembl Gene ENSMUSG00000036218
Gene Name PDZ domain containing RING finger 4
Synonyms 1110017D07Rik, SAMCAP3L, LNX4
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R5772 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 92294762-92669700 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 92655562 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 485 (E485V)
Ref Sequence ENSEMBL: ENSMUSP00000133159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]
AlphaFold E9PUZ9
Predicted Effect possibly damaging
Transcript: ENSMUST00000035399
AA Change: E246V

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: E246V

DomainStartEndE-ValueType
Blast:PDZ 1 56 4e-24 BLAST
SCOP:d1qaua_ 20 61 1e-3 SMART
PDB:1UHP|A 21 64 9e-12 PDB
PDZ 154 229 3.01e-18 SMART
low complexity region 240 259 N/A INTRINSIC
low complexity region 267 278 N/A INTRINSIC
coiled coil region 394 430 N/A INTRINSIC
low complexity region 563 577 N/A INTRINSIC
low complexity region 696 709 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169942
AA Change: E485V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: E485V

DomainStartEndE-ValueType
RING 22 56 1.38e-1 SMART
low complexity region 101 124 N/A INTRINSIC
PDZ 213 295 3.82e-20 SMART
PDZ 393 468 3.01e-18 SMART
low complexity region 479 498 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
coiled coil region 633 669 N/A INTRINSIC
low complexity region 802 816 N/A INTRINSIC
low complexity region 935 948 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
Meta Mutation Damage Score 0.1919 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932416K20Rik G A 8: 105,524,271 (GRCm39) noncoding transcript Het
Abcg8 A T 17: 84,994,127 (GRCm39) E48V probably damaging Het
Afap1l2 T C 19: 56,911,406 (GRCm39) T289A probably benign Het
Atf6 T A 1: 170,574,758 (GRCm39) D560V probably damaging Het
Bcl2l14 A T 6: 134,404,362 (GRCm39) K183N probably damaging Het
Carmil3 T C 14: 55,730,696 (GRCm39) L52P probably damaging Het
Cct3 T A 3: 88,208,274 (GRCm39) N61K probably damaging Het
Col18a1 A G 10: 77,002,177 (GRCm39) V10A unknown Het
Col26a1 G A 5: 136,876,420 (GRCm39) Q67* probably null Het
Cyp2d34 T C 15: 82,501,341 (GRCm39) D329G probably null Het
Dchs1 T A 7: 105,422,247 (GRCm39) I58F probably damaging Het
Ddx60 T C 8: 62,401,931 (GRCm39) L269P probably damaging Het
Dis3l2 G A 1: 86,806,154 (GRCm39) G325D probably damaging Het
Dync1h1 A T 12: 110,612,707 (GRCm39) K2861* probably null Het
Ednra A G 8: 78,401,696 (GRCm39) I198T possibly damaging Het
Ep300 T C 15: 81,524,115 (GRCm39) probably benign Het
Fam120a G A 13: 49,034,409 (GRCm39) P1068S probably benign Het
Fsip2 A T 2: 82,815,084 (GRCm39) M3606L probably benign Het
Garre1 A T 7: 33,953,413 (GRCm39) W238R probably damaging Het
Gm7713 T C 15: 59,866,492 (GRCm39) noncoding transcript Het
Gprin3 A T 6: 59,331,398 (GRCm39) V303D possibly damaging Het
Hmcn1 A T 1: 150,570,629 (GRCm39) V2178D possibly damaging Het
Hoxa11 A G 6: 52,222,380 (GRCm39) V107A possibly damaging Het
Iqub C A 6: 24,454,250 (GRCm39) M544I possibly damaging Het
Itgb4 A T 11: 115,879,258 (GRCm39) probably benign Het
Itpkb A G 1: 180,161,818 (GRCm39) probably benign Het
Kalrn A T 16: 33,796,190 (GRCm39) V1195E probably damaging Het
Kif12 C A 4: 63,084,178 (GRCm39) R608M probably damaging Het
Lcorl A T 5: 45,952,709 (GRCm39) probably null Het
Lrrc24 T C 15: 76,606,910 (GRCm39) E162G probably damaging Het
Med6 A G 12: 81,626,418 (GRCm39) S119P probably damaging Het
Mmab A C 5: 114,574,775 (GRCm39) L166R probably damaging Het
Myef2l A G 3: 10,153,566 (GRCm39) R112G probably damaging Het
Nom1 A G 5: 29,651,873 (GRCm39) K737R possibly damaging Het
Obscn T C 11: 58,946,970 (GRCm39) S4352G probably damaging Het
Or10ag60 A T 2: 87,438,517 (GRCm39) T262S probably benign Het
Or2w25 T A 11: 59,504,712 (GRCm39) D307E probably benign Het
Or4k35 A T 2: 111,100,057 (GRCm39) Y218* probably null Het
Or6d12 A C 6: 116,492,912 (GRCm39) D58A possibly damaging Het
Pdzrn3 G A 6: 101,149,275 (GRCm39) S351L probably benign Het
Prkdc T A 16: 15,597,252 (GRCm39) I2804K possibly damaging Het
Psg28 A G 7: 18,164,640 (GRCm39) L24P probably damaging Het
Resp18 A G 1: 75,250,644 (GRCm39) V145A possibly damaging Het
Rgl3 T C 9: 21,892,908 (GRCm39) M259V probably benign Het
Rhot2 A T 17: 26,058,781 (GRCm39) S540T probably benign Het
Ring1 T C 17: 34,241,282 (GRCm39) Y278C possibly damaging Het
Rpn2 A G 2: 157,137,265 (GRCm39) Y216C probably damaging Het
Scgb2b18 G A 7: 32,873,255 (GRCm39) L5F unknown Het
Slamf7 T C 1: 171,466,838 (GRCm39) probably null Het
Slc22a12 T C 19: 6,590,479 (GRCm39) N237S possibly damaging Het
Spen A T 4: 141,205,495 (GRCm39) V1044D unknown Het
Sqor A T 2: 122,651,261 (GRCm39) M175L probably benign Het
Stx16 G A 2: 173,935,292 (GRCm39) G156R probably damaging Het
Tars3 T G 7: 65,333,873 (GRCm39) F632V probably damaging Het
Tln1 A G 4: 43,545,191 (GRCm39) V1008A probably benign Het
Tmem145 A G 7: 25,015,039 (GRCm39) H554R probably benign Het
Trank1 A T 9: 111,195,744 (GRCm39) D1256V possibly damaging Het
Trbv19 A G 6: 41,155,794 (GRCm39) Y55C possibly damaging Het
Ttc23l C T 15: 10,551,555 (GRCm39) C57Y probably benign Het
Uap1 A T 1: 169,988,949 (GRCm39) C158S probably benign Het
Zfp353-ps T A 8: 42,535,647 (GRCm39) noncoding transcript Het
Zfp629 T A 7: 127,210,307 (GRCm39) I501F probably damaging Het
Zfp820 T C 17: 22,037,702 (GRCm39) Y542C probably damaging Het
Other mutations in Pdzrn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Pdzrn4 APN 15 92,644,159 (GRCm39) missense probably damaging 1.00
IGL01991:Pdzrn4 APN 15 92,299,807 (GRCm39) splice site probably null
IGL02103:Pdzrn4 APN 15 92,667,768 (GRCm39) missense probably damaging 1.00
IGL02243:Pdzrn4 APN 15 92,668,577 (GRCm39) missense probably benign 0.30
IGL02269:Pdzrn4 APN 15 92,667,731 (GRCm39) missense probably damaging 1.00
IGL03005:Pdzrn4 APN 15 92,668,272 (GRCm39) missense probably damaging 1.00
PIT4362001:Pdzrn4 UTSW 15 92,667,762 (GRCm39) missense possibly damaging 0.46
R0243:Pdzrn4 UTSW 15 92,668,200 (GRCm39) missense possibly damaging 0.46
R0367:Pdzrn4 UTSW 15 92,655,538 (GRCm39) missense possibly damaging 0.53
R0972:Pdzrn4 UTSW 15 92,655,592 (GRCm39) missense probably benign 0.00
R1168:Pdzrn4 UTSW 15 92,668,152 (GRCm39) missense probably benign 0.16
R1411:Pdzrn4 UTSW 15 92,668,894 (GRCm39) makesense probably null
R1466:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1466:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1489:Pdzrn4 UTSW 15 92,575,593 (GRCm39) missense probably benign
R1503:Pdzrn4 UTSW 15 92,297,685 (GRCm39) missense probably damaging 0.99
R1561:Pdzrn4 UTSW 15 92,575,518 (GRCm39) missense possibly damaging 0.84
R1584:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1733:Pdzrn4 UTSW 15 92,299,855 (GRCm39) missense probably benign 0.06
R1965:Pdzrn4 UTSW 15 92,644,190 (GRCm39) splice site probably null
R2061:Pdzrn4 UTSW 15 92,668,041 (GRCm39) missense probably damaging 0.99
R3010:Pdzrn4 UTSW 15 92,667,692 (GRCm39) missense probably benign 0.32
R4016:Pdzrn4 UTSW 15 92,297,630 (GRCm39) missense probably benign
R4032:Pdzrn4 UTSW 15 92,667,414 (GRCm39) missense probably damaging 1.00
R4110:Pdzrn4 UTSW 15 92,668,745 (GRCm39) missense probably benign 0.26
R4180:Pdzrn4 UTSW 15 92,299,898 (GRCm39) missense possibly damaging 0.93
R4539:Pdzrn4 UTSW 15 92,668,470 (GRCm39) missense probably damaging 1.00
R4617:Pdzrn4 UTSW 15 92,667,723 (GRCm39) missense probably damaging 1.00
R4734:Pdzrn4 UTSW 15 92,668,133 (GRCm39) nonsense probably null
R4900:Pdzrn4 UTSW 15 92,668,638 (GRCm39) missense probably damaging 1.00
R5422:Pdzrn4 UTSW 15 92,575,502 (GRCm39) missense probably benign 0.01
R5444:Pdzrn4 UTSW 15 92,668,806 (GRCm39) missense probably damaging 1.00
R5775:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R5935:Pdzrn4 UTSW 15 92,295,255 (GRCm39) missense probably benign 0.01
R6192:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6210:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6258:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6259:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6391:Pdzrn4 UTSW 15 92,578,418 (GRCm39) missense probably damaging 0.99
R6613:Pdzrn4 UTSW 15 92,575,455 (GRCm39) missense probably damaging 0.99
R7046:Pdzrn4 UTSW 15 92,668,303 (GRCm39) nonsense probably null
R7096:Pdzrn4 UTSW 15 92,295,384 (GRCm39) missense probably benign 0.00
R7451:Pdzrn4 UTSW 15 92,667,948 (GRCm39) missense possibly damaging 0.68
R8075:Pdzrn4 UTSW 15 92,575,605 (GRCm39) missense probably damaging 0.99
R8125:Pdzrn4 UTSW 15 92,641,476 (GRCm39) missense probably damaging 1.00
R8324:Pdzrn4 UTSW 15 92,668,818 (GRCm39) missense probably damaging 1.00
R9332:Pdzrn4 UTSW 15 92,295,216 (GRCm39) missense probably benign
R9555:Pdzrn4 UTSW 15 92,297,703 (GRCm39) missense probably damaging 1.00
R9558:Pdzrn4 UTSW 15 92,299,877 (GRCm39) missense possibly damaging 0.46
R9622:Pdzrn4 UTSW 15 92,294,949 (GRCm39) missense probably benign
R9763:Pdzrn4 UTSW 15 92,668,376 (GRCm39) missense probably damaging 1.00
R9796:Pdzrn4 UTSW 15 92,578,353 (GRCm39) missense possibly damaging 0.93
X0018:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0020:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0021:Pdzrn4 UTSW 15 92,575,590 (GRCm39) missense probably damaging 1.00
X0026:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92,578,393 (GRCm39) missense possibly damaging 0.92
X0027:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0065:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
Z1176:Pdzrn4 UTSW 15 92,294,838 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGTTTCAGGAGAGGATAAAAGGCC -3'
(R):5'- AAGATCGTTTGCCCCGAAAG -3'

Sequencing Primer
(F):5'- CTTCTTTCTGAGAGGTGACCAGAG -3'
(R):5'- CGTTTGCCCCGAAAGATTATG -3'
Posted On 2016-11-21