Incidental Mutation 'R0029:Tmem63a'
ID44549
Institutional Source Beutler Lab
Gene Symbol Tmem63a
Ensembl Gene ENSMUSG00000026519
Gene Nametransmembrane protein 63a
Synonyms
MMRRC Submission 038323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R0029 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180942344-180975112 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180962466 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 401 (Y401C)
Ref Sequence ENSEMBL: ENSMUSP00000124021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027800] [ENSMUST00000161523]
Predicted Effect probably benign
Transcript: ENSMUST00000027800
AA Change: Y401C

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000027800
Gene: ENSMUSG00000026519
AA Change: Y401C

DomainStartEndE-ValueType
Pfam:RSN1_TM 50 213 3.3e-24 PFAM
Pfam:PHM7_cyt 261 327 8.2e-12 PFAM
Pfam:RSN1_7TM 349 692 1.5e-87 PFAM
transmembrane domain 697 719 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128545
Predicted Effect probably benign
Transcript: ENSMUST00000161523
AA Change: Y401C

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124021
Gene: ENSMUSG00000026519
AA Change: Y401C

DomainStartEndE-ValueType
Pfam:RSN1_TM 50 213 3.6e-25 PFAM
Pfam:DUF4463 261 326 9.4e-15 PFAM
Pfam:DUF221 349 692 1.4e-87 PFAM
transmembrane domain 697 719 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161942
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency 94% (48/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik T C 15: 98,585,309 probably null Het
Abca15 T C 7: 120,346,002 F434L probably benign Het
Abt1 A T 13: 23,422,508 F141Y possibly damaging Het
Anapc15-ps A G 10: 95,672,995 I141T probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Axin2 A G 11: 108,924,047 T254A probably benign Het
Ciz1 A G 2: 32,371,419 probably benign Het
Cpa4 A G 6: 30,585,045 Y276C probably damaging Het
Cpt1a A G 19: 3,381,674 D698G probably benign Het
Crebbp T C 16: 4,117,443 T861A probably damaging Het
Dpy19l2 T A 9: 24,558,101 D753V probably damaging Het
Exosc7 A T 9: 123,119,237 probably benign Het
Fbxw28 T A 9: 109,328,289 D244V probably damaging Het
Fgd5 A G 6: 92,067,558 D1260G probably benign Het
Gapvd1 T A 2: 34,678,141 I1404F probably damaging Het
Gas7 A G 11: 67,643,337 S88G probably benign Het
Hk1 T C 10: 62,315,394 D57G probably damaging Het
Il23r A C 6: 67,478,945 probably null Het
Impg1 T C 9: 80,398,371 D138G probably damaging Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Kirrel2 A G 7: 30,453,165 probably benign Het
Lipm T C 19: 34,116,548 probably benign Het
Lrpap1 T C 5: 35,097,677 N205S possibly damaging Het
Mboat4 T G 8: 34,120,209 F87V probably damaging Het
Nadsyn1 G C 7: 143,806,078 Q386E probably benign Het
Nell1 G A 7: 50,120,715 probably benign Het
Olfr209 T C 16: 59,361,541 R226G probably benign Het
Olfr955 T A 9: 39,470,660 E22V probably benign Het
Pard3 G T 8: 127,426,758 probably benign Het
Per2 C A 1: 91,423,712 R1024L possibly damaging Het
Phf11c T C 14: 59,384,915 D216G probably benign Het
Polk G A 13: 96,516,670 T74I probably damaging Het
Prmt6 T C 3: 110,249,898 I358M probably benign Het
Psmb7 T A 2: 38,633,907 H152L probably damaging Het
Ralgps1 A T 2: 33,141,019 D498E probably benign Het
Slc26a2 G A 18: 61,202,310 P24S possibly damaging Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Stk38 T C 17: 28,982,138 E188G probably benign Het
Sulf2 T C 2: 166,116,973 N105S possibly damaging Het
Sult2a3 T A 7: 14,073,074 M228L probably benign Het
Svil C A 18: 5,063,286 D852E probably benign Het
Tcaf2 A T 6: 42,630,159 L287* probably null Het
Tmem132e A T 11: 82,444,761 I890F probably damaging Het
Ttn T C 2: 76,766,506 E20021G probably damaging Het
Ubac1 G T 2: 26,021,443 T31N probably benign Het
Usp29 T C 7: 6,961,581 L141P probably damaging Het
Vmn1r179 A T 7: 23,929,205 I274F probably benign Het
Vmn1r204 A G 13: 22,556,418 Y73C probably benign Het
Vmn2r2 T C 3: 64,116,944 I739V probably benign Het
Wisp1 C T 15: 66,912,864 R129C probably damaging Het
Other mutations in Tmem63a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Tmem63a APN 1 180963088 missense probably damaging 1.00
IGL00331:Tmem63a APN 1 180966497 missense possibly damaging 0.46
IGL01116:Tmem63a APN 1 180972089 missense probably damaging 0.96
IGL01368:Tmem63a APN 1 180970232 missense possibly damaging 0.69
IGL01445:Tmem63a APN 1 180946631 missense probably damaging 1.00
IGL01867:Tmem63a APN 1 180956005 missense possibly damaging 0.87
IGL02043:Tmem63a APN 1 180972788 missense probably benign 0.11
IGL02453:Tmem63a APN 1 180963069 missense probably benign 0.02
IGL02527:Tmem63a APN 1 180952974 splice site probably null
IGL02811:Tmem63a APN 1 180965783 missense probably damaging 0.99
IGL02975:Tmem63a APN 1 180961075 missense probably benign
IGL03304:Tmem63a APN 1 180968853 nonsense probably null
R0029:Tmem63a UTSW 1 180962466 missense probably benign 0.01
R0173:Tmem63a UTSW 1 180954798 splice site probably benign
R0358:Tmem63a UTSW 1 180956423 missense probably benign 0.17
R0436:Tmem63a UTSW 1 180972733 missense probably benign 0.03
R0506:Tmem63a UTSW 1 180958049 critical splice donor site probably null
R0513:Tmem63a UTSW 1 180960461 missense probably benign 0.00
R0529:Tmem63a UTSW 1 180961094 missense probably benign 0.09
R0855:Tmem63a UTSW 1 180961060 missense possibly damaging 0.82
R1633:Tmem63a UTSW 1 180948826 missense probably damaging 0.98
R2129:Tmem63a UTSW 1 180965540 missense probably benign 0.00
R2212:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R2214:Tmem63a UTSW 1 180961114 missense probably benign 0.00
R2413:Tmem63a UTSW 1 180961075 missense probably benign
R2437:Tmem63a UTSW 1 180962489 splice site probably null
R3703:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3704:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3705:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3714:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3746:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3747:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3961:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3963:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R4675:Tmem63a UTSW 1 180956491 missense probably benign 0.00
R4795:Tmem63a UTSW 1 180954851 missense probably damaging 1.00
R4876:Tmem63a UTSW 1 180973186 missense probably benign
R4916:Tmem63a UTSW 1 180966521 missense probably benign 0.36
R4917:Tmem63a UTSW 1 180966521 missense probably benign 0.36
R4918:Tmem63a UTSW 1 180966521 missense probably benign 0.36
R5620:Tmem63a UTSW 1 180970246 missense probably benign 0.00
R5843:Tmem63a UTSW 1 180972833 critical splice donor site probably null
R5937:Tmem63a UTSW 1 180961151 missense probably damaging 1.00
R6823:Tmem63a UTSW 1 180960470 missense possibly damaging 0.60
R6990:Tmem63a UTSW 1 180961121 missense probably benign 0.02
R7075:Tmem63a UTSW 1 180961149 missense probably damaging 1.00
R7129:Tmem63a UTSW 1 180954876 missense probably damaging 0.98
R7447:Tmem63a UTSW 1 180958023 missense probably benign 0.04
R7609:Tmem63a UTSW 1 180952974 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCTCACAGGTGACATGCAGTAACAG -3'
(R):5'- TCGGGTGAACTTTAGGGAAGCCAG -3'

Sequencing Primer
(F):5'- GTGACATGCAGTAACAGCTTTG -3'
(R):5'- caggaagcagaggcagg -3'
Posted On2013-06-11