Incidental Mutation 'R5773:Fhad1'
ID445493
Institutional Source Beutler Lab
Gene Symbol Fhad1
Ensembl Gene ENSMUSG00000051435
Gene Nameforkhead-associated (FHA) phosphopeptide binding domain 1
Synonyms
MMRRC Submission 043372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5773 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location141890438-142015082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 141929570 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 91 (K91T)
Ref Sequence ENSEMBL: ENSMUSP00000036224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036701] [ENSMUST00000105779] [ENSMUST00000105780]
Predicted Effect probably damaging
Transcript: ENSMUST00000036701
AA Change: K91T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036224
Gene: ENSMUSG00000051435
AA Change: K91T

DomainStartEndE-ValueType
coiled coil region 31 250 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105779
AA Change: K756T

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101405
Gene: ENSMUSG00000051435
AA Change: K756T

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105780
AA Change: K756T

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101406
Gene: ENSMUSG00000051435
AA Change: K756T

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129192
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 G A 2: 155,574,694 probably null Het
Akna C T 4: 63,395,070 S272N probably benign Het
Ap2m1 T C 16: 20,543,390 V416A probably damaging Het
Atp7b A G 8: 22,027,863 F320L probably benign Het
Brd1 T C 15: 88,689,549 K1116E probably benign Het
Ccdc186 T C 19: 56,813,487 D66G probably benign Het
Cdh4 A G 2: 179,885,996 Y503C probably damaging Het
Cfb C A 17: 34,857,272 E166* probably null Het
Cmtm1 A T 8: 104,305,176 F90I probably damaging Het
Col1a1 A T 11: 94,939,429 K160N probably benign Het
Cradd T C 10: 95,175,961 I106V probably benign Het
Defa17 A G 8: 21,656,558 R67G probably damaging Het
Dgkh T C 14: 78,595,455 N765S probably damaging Het
Dock5 A G 14: 67,796,058 V954A possibly damaging Het
Eif2d A G 1: 131,158,303 probably null Het
Epg5 T A 18: 77,960,825 F683I probably damaging Het
Fut11 A T 14: 20,698,315 D476V probably damaging Het
Gldn T C 9: 54,334,491 probably null Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm8674 T A 13: 49,901,876 noncoding transcript Het
Gtpbp6 C A 5: 110,106,891 E168D possibly damaging Het
Hinfp T A 9: 44,299,236 H163L probably benign Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Ing3 T A 6: 21,971,835 C368S probably damaging Het
Itih1 A G 14: 30,935,399 V489A possibly damaging Het
Itsn2 T C 12: 4,707,089 L1393P probably damaging Het
Kcnj13 T C 1: 87,386,667 T278A probably damaging Het
Kntc1 G A 5: 123,794,157 R1338Q probably damaging Het
Lipi T A 16: 75,573,925 T135S probably damaging Het
Map7 A G 10: 20,246,644 K152R probably benign Het
Mmp24 A G 2: 155,799,909 Y219C probably damaging Het
Nup188 T C 2: 30,322,196 V565A possibly damaging Het
Nup210 T C 6: 91,085,883 K265E probably damaging Het
Olfr1331 A G 4: 118,869,521 T247A probably damaging Het
Pcdha6 A T 18: 36,969,590 H612L probably benign Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pld2 G T 11: 70,555,932 S778I probably damaging Het
Ppef2 A C 5: 92,250,561 Y33D probably damaging Het
Ppfibp2 A T 7: 107,685,872 T129S possibly damaging Het
Prickle1 G T 15: 93,508,597 H182N probably damaging Het
R3hdm2 T A 10: 127,444,303 probably benign Het
Rbm12b1 A T 4: 12,145,765 E579V probably damaging Het
Rsf1 GGC GGCGGCGGCTGC 7: 97,579,933 probably benign Het
Slc1a6 T G 10: 78,793,277 probably null Het
Slc27a6 G T 18: 58,582,173 A283S probably damaging Het
Spats2l T A 1: 57,879,549 N27K possibly damaging Het
Srgap1 T C 10: 121,896,709 M155V probably benign Het
Stxbp5l C A 16: 37,208,097 A535S probably damaging Het
Svep1 C A 4: 58,099,985 C1353F possibly damaging Het
Taar4 T A 10: 23,961,158 I222N probably damaging Het
Tlr6 A G 5: 64,954,503 F354L probably benign Het
Trp53bp1 A G 2: 121,243,914 S452P probably damaging Het
Ttll5 GCCCTGCGGGGCTGCCACGCTGTCGATCCGGCAGCTAC G 12: 85,933,555 probably null Het
Usp42 A T 5: 143,713,712 M1264K probably benign Het
Zfp865 A T 7: 5,034,694 probably benign Het
Zfyve26 A T 12: 79,287,737 L169Q probably damaging Het
Zmym4 A T 4: 126,905,370 N383K possibly damaging Het
Other mutations in Fhad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fhad1 APN 4 141905612 missense probably benign 0.02
IGL01478:Fhad1 APN 4 141951638 missense possibly damaging 0.84
IGL01752:Fhad1 APN 4 141972899 missense possibly damaging 0.82
IGL01788:Fhad1 APN 4 141932802 missense probably benign 0.00
IGL01919:Fhad1 APN 4 141964595 missense probably damaging 0.96
IGL02489:Fhad1 APN 4 141957620 missense probably damaging 0.97
IGL02568:Fhad1 APN 4 141932794 missense probably null 1.00
IGL02583:Fhad1 APN 4 142011644 utr 5 prime probably benign
IGL02716:Fhad1 APN 4 141918331 missense possibly damaging 0.89
IGL02819:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL02820:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL03038:Fhad1 APN 4 142002494 missense probably benign 0.38
IGL03167:Fhad1 APN 4 141972797 missense probably benign 0.00
IGL03255:Fhad1 APN 4 141972880 missense possibly damaging 0.79
PIT1430001:Fhad1 UTSW 4 141909749 missense probably damaging 0.99
R0014:Fhad1 UTSW 4 141928408 missense probably damaging 1.00
R0116:Fhad1 UTSW 4 141940095 missense probably benign 0.06
R0143:Fhad1 UTSW 4 141929646 splice site probably benign
R0178:Fhad1 UTSW 4 141955340 missense probably benign 0.31
R0308:Fhad1 UTSW 4 141985593 splice site probably benign
R0384:Fhad1 UTSW 4 142002426 missense probably benign
R0583:Fhad1 UTSW 4 141903990 missense probably benign 0.37
R1501:Fhad1 UTSW 4 141964625 missense probably benign
R1584:Fhad1 UTSW 4 141985511 missense probably benign 0.22
R1615:Fhad1 UTSW 4 141922323 missense probably damaging 0.99
R1991:Fhad1 UTSW 4 141982162 missense possibly damaging 0.75
R2060:Fhad1 UTSW 4 141899249 missense probably benign 0.08
R2079:Fhad1 UTSW 4 141991202 nonsense probably null
R2133:Fhad1 UTSW 4 141928400 missense probably damaging 1.00
R2337:Fhad1 UTSW 4 141922344 missense possibly damaging 0.84
R2843:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2844:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2845:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2846:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2866:Fhad1 UTSW 4 141920788 missense probably benign 0.00
R3119:Fhad1 UTSW 4 141918307 frame shift probably null
R3760:Fhad1 UTSW 4 141909813 missense probably damaging 1.00
R4180:Fhad1 UTSW 4 141985543 missense possibly damaging 0.69
R4466:Fhad1 UTSW 4 141957658 missense probably damaging 1.00
R4627:Fhad1 UTSW 4 141896468 missense possibly damaging 0.47
R4680:Fhad1 UTSW 4 142011547 nonsense probably null
R4725:Fhad1 UTSW 4 141928378 critical splice donor site probably null
R4755:Fhad1 UTSW 4 141928483 missense probably damaging 1.00
R4831:Fhad1 UTSW 4 141916067 splice site probably null
R4909:Fhad1 UTSW 4 141985511 missense probably benign 0.01
R4968:Fhad1 UTSW 4 141918307 missense probably damaging 1.00
R5004:Fhad1 UTSW 4 142002599 critical splice acceptor site probably null
R5036:Fhad1 UTSW 4 141920741 missense probably benign 0.03
R5048:Fhad1 UTSW 4 141964676 critical splice acceptor site probably null
R5416:Fhad1 UTSW 4 141918802 missense probably benign 0.39
R5504:Fhad1 UTSW 4 141985535 missense probably benign
R5586:Fhad1 UTSW 4 141905131 missense probably benign 0.44
R5692:Fhad1 UTSW 4 141963457 missense probably benign 0.00
R5706:Fhad1 UTSW 4 141954116 missense probably damaging 1.00
R5823:Fhad1 UTSW 4 141955306 missense possibly damaging 0.84
R5833:Fhad1 UTSW 4 142002527 missense probably damaging 1.00
R6170:Fhad1 UTSW 4 141890952 nonsense probably null
R6286:Fhad1 UTSW 4 141920898 missense probably damaging 1.00
R6610:Fhad1 UTSW 4 141916396 missense possibly damaging 0.94
R6755:Fhad1 UTSW 4 141964604 missense probably damaging 1.00
R7006:Fhad1 UTSW 4 141918291 frame shift probably null
R7008:Fhad1 UTSW 4 141918291 frame shift probably null
R7012:Fhad1 UTSW 4 141918291 frame shift probably null
R7014:Fhad1 UTSW 4 141918291 frame shift probably null
R7058:Fhad1 UTSW 4 141918291 frame shift probably null
R7059:Fhad1 UTSW 4 141918291 frame shift probably null
R7060:Fhad1 UTSW 4 141918291 frame shift probably null
R7159:Fhad1 UTSW 4 141951616 missense probably benign 0.01
R7472:Fhad1 UTSW 4 141964626 missense probably benign
X0018:Fhad1 UTSW 4 141951616 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACTGAGTGGCAAGTGTTGG -3'
(R):5'- TTCCTCTTAACAGGTGCCG -3'

Sequencing Primer
(F):5'- CAAGTGTTGGCTACTTCCAGCAG -3'
(R):5'- GGCTCCTGGTTTCCTGATCTATAAC -3'
Posted On2016-11-21