Incidental Mutation 'R5773:Tlr6'
ID445494
Institutional Source Beutler Lab
Gene Symbol Tlr6
Ensembl Gene ENSMUSG00000051498
Gene Nametoll-like receptor 6
Synonyms
MMRRC Submission 043372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R5773 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location64952031-64960097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64954503 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 354 (F354L)
Ref Sequence ENSEMBL: ENSMUSP00000062096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062315] [ENSMUST00000201307]
Predicted Effect probably benign
Transcript: ENSMUST00000062315
AA Change: F354L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000062096
Gene: ENSMUSG00000051498
AA Change: F354L

DomainStartEndE-ValueType
LRR_TYP 86 109 7.67e-2 SMART
LRR 131 155 2.76e1 SMART
LRR 461 482 6.23e1 SMART
LRR 483 507 4.57e0 SMART
LRRCT 540 594 4.06e-11 SMART
transmembrane domain 596 618 N/A INTRINSIC
TIR 652 795 5.37e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201307
SMART Domains Protein: ENSMUSP00000143865
Gene: ENSMUSG00000051498

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
LRR_TYP 86 109 3.3e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor functionally interacts with toll-like receptor 2 to mediate cellular response to bacterial lipoproteins. A Ser249Pro polymorphism in the extracellular domain of the encoded protein may be associated with an increased of asthma is some populations.[provided by RefSeq, Jan 2011]
PHENOTYPE: Inactivation of this gene results in abnormal macrophage function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 G A 2: 155,574,694 probably null Het
Akna C T 4: 63,395,070 S272N probably benign Het
Ap2m1 T C 16: 20,543,390 V416A probably damaging Het
Atp7b A G 8: 22,027,863 F320L probably benign Het
Brd1 T C 15: 88,689,549 K1116E probably benign Het
Ccdc186 T C 19: 56,813,487 D66G probably benign Het
Cdh4 A G 2: 179,885,996 Y503C probably damaging Het
Cfb C A 17: 34,857,272 E166* probably null Het
Cmtm1 A T 8: 104,305,176 F90I probably damaging Het
Col1a1 A T 11: 94,939,429 K160N probably benign Het
Cradd T C 10: 95,175,961 I106V probably benign Het
Defa17 A G 8: 21,656,558 R67G probably damaging Het
Dgkh T C 14: 78,595,455 N765S probably damaging Het
Dock5 A G 14: 67,796,058 V954A possibly damaging Het
Eif2d A G 1: 131,158,303 probably null Het
Epg5 T A 18: 77,960,825 F683I probably damaging Het
Fhad1 T G 4: 141,929,570 K91T probably damaging Het
Fut11 A T 14: 20,698,315 D476V probably damaging Het
Gldn T C 9: 54,334,491 probably null Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm8674 T A 13: 49,901,876 noncoding transcript Het
Gtpbp6 C A 5: 110,106,891 E168D possibly damaging Het
Hinfp T A 9: 44,299,236 H163L probably benign Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Ing3 T A 6: 21,971,835 C368S probably damaging Het
Itih1 A G 14: 30,935,399 V489A possibly damaging Het
Itsn2 T C 12: 4,707,089 L1393P probably damaging Het
Kcnj13 T C 1: 87,386,667 T278A probably damaging Het
Kntc1 G A 5: 123,794,157 R1338Q probably damaging Het
Lipi T A 16: 75,573,925 T135S probably damaging Het
Map7 A G 10: 20,246,644 K152R probably benign Het
Mmp24 A G 2: 155,799,909 Y219C probably damaging Het
Nup188 T C 2: 30,322,196 V565A possibly damaging Het
Nup210 T C 6: 91,085,883 K265E probably damaging Het
Olfr1331 A G 4: 118,869,521 T247A probably damaging Het
Pcdha6 A T 18: 36,969,590 H612L probably benign Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pld2 G T 11: 70,555,932 S778I probably damaging Het
Ppef2 A C 5: 92,250,561 Y33D probably damaging Het
Ppfibp2 A T 7: 107,685,872 T129S possibly damaging Het
Prickle1 G T 15: 93,508,597 H182N probably damaging Het
R3hdm2 T A 10: 127,444,303 probably benign Het
Rbm12b1 A T 4: 12,145,765 E579V probably damaging Het
Rsf1 GGC GGCGGCGGCTGC 7: 97,579,933 probably benign Het
Slc1a6 T G 10: 78,793,277 probably null Het
Slc27a6 G T 18: 58,582,173 A283S probably damaging Het
Spats2l T A 1: 57,879,549 N27K possibly damaging Het
Srgap1 T C 10: 121,896,709 M155V probably benign Het
Stxbp5l C A 16: 37,208,097 A535S probably damaging Het
Svep1 C A 4: 58,099,985 C1353F possibly damaging Het
Taar4 T A 10: 23,961,158 I222N probably damaging Het
Trp53bp1 A G 2: 121,243,914 S452P probably damaging Het
Ttll5 GCCCTGCGGGGCTGCCACGCTGTCGATCCGGCAGCTAC G 12: 85,933,555 probably null Het
Usp42 A T 5: 143,713,712 M1264K probably benign Het
Zfp865 A T 7: 5,034,694 probably benign Het
Zfyve26 A T 12: 79,287,737 L169Q probably damaging Het
Zmym4 A T 4: 126,905,370 N383K possibly damaging Het
Other mutations in Tlr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Tlr6 APN 5 64953512 missense probably damaging 1.00
IGL00963:Tlr6 APN 5 64954676 missense possibly damaging 0.89
IGL01540:Tlr6 APN 5 64955286 missense probably damaging 0.97
IGL01675:Tlr6 APN 5 64954499 missense probably damaging 1.00
IGL01705:Tlr6 APN 5 64954130 missense probably benign 0.03
IGL02256:Tlr6 APN 5 64954944 missense probably benign 0.00
Counterintuitive UTSW 5 64953595 missense probably damaging 1.00
insouciant UTSW 5 64954583 missense possibly damaging 0.81
m2sd1 UTSW 5 64954194 nonsense
m2sd2 UTSW 5 64954394 nonsense
m2sd3 UTSW 5 64954241 missense probably damaging 0.98
One_off UTSW 5 64953251 missense probably damaging 1.00
R0336:Tlr6 UTSW 5 64953946 missense probably benign 0.02
R0388:Tlr6 UTSW 5 64955205 missense possibly damaging 0.74
R0558:Tlr6 UTSW 5 64954860 nonsense probably null
R0671:Tlr6 UTSW 5 64954592 missense probably benign 0.00
R1171:Tlr6 UTSW 5 64955250 missense probably benign 0.00
R1550:Tlr6 UTSW 5 64953411 missense probably damaging 0.98
R1809:Tlr6 UTSW 5 64953712 nonsense probably null
R1868:Tlr6 UTSW 5 64954829 missense probably benign 0.00
R1876:Tlr6 UTSW 5 64955420 missense probably damaging 1.00
R1893:Tlr6 UTSW 5 64953213 missense probably damaging 1.00
R2006:Tlr6 UTSW 5 64953405 missense probably damaging 1.00
R2055:Tlr6 UTSW 5 64953926 missense probably damaging 1.00
R3087:Tlr6 UTSW 5 64954325 missense probably damaging 1.00
R3406:Tlr6 UTSW 5 64953429 missense probably damaging 1.00
R3711:Tlr6 UTSW 5 64953809 missense possibly damaging 0.75
R3938:Tlr6 UTSW 5 64953595 missense probably damaging 1.00
R3962:Tlr6 UTSW 5 64954985 missense probably benign 0.10
R4152:Tlr6 UTSW 5 64953212 missense probably damaging 1.00
R4274:Tlr6 UTSW 5 64953638 missense probably benign 0.01
R4516:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4518:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4762:Tlr6 UTSW 5 64954396 missense probably benign 0.09
R4959:Tlr6 UTSW 5 64953659 missense possibly damaging 0.81
R5119:Tlr6 UTSW 5 64954301 missense probably benign 0.06
R5248:Tlr6 UTSW 5 64955304 missense probably benign 0.30
R5507:Tlr6 UTSW 5 64953406 missense probably damaging 1.00
R5572:Tlr6 UTSW 5 64955018 missense probably damaging 1.00
R6711:Tlr6 UTSW 5 64954492 missense probably damaging 1.00
R7096:Tlr6 UTSW 5 64953776 missense probably benign
R7341:Tlr6 UTSW 5 64953629 missense probably benign 0.32
R7594:Tlr6 UTSW 5 64953251 missense probably damaging 1.00
R7754:Tlr6 UTSW 5 64954350 missense possibly damaging 0.64
R7774:Tlr6 UTSW 5 64953385 missense probably damaging 0.99
Z1177:Tlr6 UTSW 5 64955239 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCAGAGAGGACATATTCTTAGTCATG -3'
(R):5'- AATTCTTTTGGCCCCGACCG -3'

Sequencing Primer
(F):5'- GAGGACATATTCTTAGTCATGAGAGC -3'
(R):5'- GGTGGAGTACCTCAATATTTACAAC -3'
Posted On2016-11-21