Incidental Mutation 'R0029:Gapvd1'
ID44553
Institutional Source Beutler Lab
Gene Symbol Gapvd1
Ensembl Gene ENSMUSG00000026867
Gene NameGTPase activating protein and VPS9 domains 1
Synonyms4432404J10Rik, 2010005B09Rik
MMRRC Submission 038323-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0029 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location34674594-34755232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34678141 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1404 (I1404F)
Ref Sequence ENSEMBL: ENSMUSP00000099864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028224] [ENSMUST00000102800] [ENSMUST00000113099]
Predicted Effect probably damaging
Transcript: ENSMUST00000028224
AA Change: I1404F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028224
Gene: ENSMUSG00000026867
AA Change: I1404F

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.3e-36 PFAM
internal_repeat_1 626 655 3.27e-5 PROSPERO
low complexity region 664 678 N/A INTRINSIC
internal_repeat_1 686 717 3.27e-5 PROSPERO
low complexity region 875 890 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
VPS9 1332 1437 1.08e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102800
AA Change: I1404F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099864
Gene: ENSMUSG00000026867
AA Change: I1404F

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.3e-36 PFAM
internal_repeat_1 626 655 3.27e-5 PROSPERO
low complexity region 664 678 N/A INTRINSIC
internal_repeat_1 686 717 3.27e-5 PROSPERO
low complexity region 875 890 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
VPS9 1332 1437 1.08e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113099
AA Change: I1425F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108723
Gene: ENSMUSG00000026867
AA Change: I1425F

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.8e-37 PFAM
internal_repeat_1 647 676 3.6e-5 PROSPERO
low complexity region 685 699 N/A INTRINSIC
internal_repeat_1 707 738 3.6e-5 PROSPERO
low complexity region 896 911 N/A INTRINSIC
low complexity region 930 941 N/A INTRINSIC
low complexity region 944 954 N/A INTRINSIC
low complexity region 957 973 N/A INTRINSIC
low complexity region 993 1003 N/A INTRINSIC
VPS9 1353 1458 1.08e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113101
AA Change: I514F
SMART Domains Protein: ENSMUSP00000108725
Gene: ENSMUSG00000026867
AA Change: I514F

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 61 71 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
VPS9 443 548 1.08e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113111
AA Change: I862F
SMART Domains Protein: ENSMUSP00000108735
Gene: ENSMUSG00000026867
AA Change: I862F

DomainStartEndE-ValueType
internal_repeat_1 85 114 3.65e-6 PROSPERO
low complexity region 123 137 N/A INTRINSIC
internal_repeat_1 145 176 3.65e-6 PROSPERO
low complexity region 334 349 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
low complexity region 382 392 N/A INTRINSIC
low complexity region 395 411 N/A INTRINSIC
low complexity region 431 441 N/A INTRINSIC
VPS9 791 896 1.08e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138203
Meta Mutation Damage Score 0.41 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency 94% (48/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik T C 15: 98,585,309 probably null Het
Abca15 T C 7: 120,346,002 F434L probably benign Het
Abt1 A T 13: 23,422,508 F141Y possibly damaging Het
Anapc15-ps A G 10: 95,672,995 I141T probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Axin2 A G 11: 108,924,047 T254A probably benign Het
Ciz1 A G 2: 32,371,419 probably benign Het
Cpa4 A G 6: 30,585,045 Y276C probably damaging Het
Cpt1a A G 19: 3,381,674 D698G probably benign Het
Crebbp T C 16: 4,117,443 T861A probably damaging Het
Dpy19l2 T A 9: 24,558,101 D753V probably damaging Het
Exosc7 A T 9: 123,119,237 probably benign Het
Fbxw28 T A 9: 109,328,289 D244V probably damaging Het
Fgd5 A G 6: 92,067,558 D1260G probably benign Het
Gas7 A G 11: 67,643,337 S88G probably benign Het
Hk1 T C 10: 62,315,394 D57G probably damaging Het
Il23r A C 6: 67,478,945 probably null Het
Impg1 T C 9: 80,398,371 D138G probably damaging Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Kirrel2 A G 7: 30,453,165 probably benign Het
Lipm T C 19: 34,116,548 probably benign Het
Lrpap1 T C 5: 35,097,677 N205S possibly damaging Het
Mboat4 T G 8: 34,120,209 F87V probably damaging Het
Nadsyn1 G C 7: 143,806,078 Q386E probably benign Het
Nell1 G A 7: 50,120,715 probably benign Het
Olfr209 T C 16: 59,361,541 R226G probably benign Het
Olfr955 T A 9: 39,470,660 E22V probably benign Het
Pard3 G T 8: 127,426,758 probably benign Het
Per2 C A 1: 91,423,712 R1024L possibly damaging Het
Phf11c T C 14: 59,384,915 D216G probably benign Het
Polk G A 13: 96,516,670 T74I probably damaging Het
Prmt6 T C 3: 110,249,898 I358M probably benign Het
Psmb7 T A 2: 38,633,907 H152L probably damaging Het
Ralgps1 A T 2: 33,141,019 D498E probably benign Het
Slc26a2 G A 18: 61,202,310 P24S possibly damaging Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Stk38 T C 17: 28,982,138 E188G probably benign Het
Sulf2 T C 2: 166,116,973 N105S possibly damaging Het
Sult2a3 T A 7: 14,073,074 M228L probably benign Het
Svil C A 18: 5,063,286 D852E probably benign Het
Tcaf2 A T 6: 42,630,159 L287* probably null Het
Tmem132e A T 11: 82,444,761 I890F probably damaging Het
Tmem63a A G 1: 180,962,466 Y401C probably benign Het
Ttn T C 2: 76,766,506 E20021G probably damaging Het
Ubac1 G T 2: 26,021,443 T31N probably benign Het
Usp29 T C 7: 6,961,581 L141P probably damaging Het
Vmn1r179 A T 7: 23,929,205 I274F probably benign Het
Vmn1r204 A G 13: 22,556,418 Y73C probably benign Het
Vmn2r2 T C 3: 64,116,944 I739V probably benign Het
Wisp1 C T 15: 66,912,864 R129C probably damaging Het
Other mutations in Gapvd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Gapvd1 APN 2 34699860 missense probably benign 0.00
IGL00985:Gapvd1 APN 2 34695563 missense probably damaging 0.99
IGL01133:Gapvd1 APN 2 34725398 missense probably damaging 0.98
IGL01347:Gapvd1 APN 2 34706696 critical splice donor site probably null
IGL01830:Gapvd1 APN 2 34688956 missense probably benign 0.44
IGL01865:Gapvd1 APN 2 34695503 missense probably null
IGL02009:Gapvd1 APN 2 34704191 missense probably damaging 1.00
IGL02014:Gapvd1 APN 2 34704191 missense probably damaging 1.00
IGL02189:Gapvd1 APN 2 34728544 missense probably damaging 1.00
IGL02418:Gapvd1 APN 2 34730518 missense probably benign 0.00
IGL02632:Gapvd1 APN 2 34684174 splice site probably benign
IGL02636:Gapvd1 APN 2 34725404 missense probably benign 0.01
IGL02643:Gapvd1 APN 2 34704180 missense probably damaging 1.00
IGL03271:Gapvd1 APN 2 34727207 unclassified probably benign
P0023:Gapvd1 UTSW 2 34706688 splice site probably benign
R0016:Gapvd1 UTSW 2 34699913 splice site probably benign
R0016:Gapvd1 UTSW 2 34699913 splice site probably benign
R0029:Gapvd1 UTSW 2 34678141 missense probably damaging 1.00
R0282:Gapvd1 UTSW 2 34688960 nonsense probably null
R0414:Gapvd1 UTSW 2 34693427 missense probably benign 0.14
R0443:Gapvd1 UTSW 2 34704621 intron probably benign
R0542:Gapvd1 UTSW 2 34725036 unclassified probably benign
R0570:Gapvd1 UTSW 2 34728540 missense probably damaging 1.00
R0840:Gapvd1 UTSW 2 34729113 missense probably benign 0.29
R0866:Gapvd1 UTSW 2 34709217 missense probably damaging 1.00
R0890:Gapvd1 UTSW 2 34712317 missense probably damaging 1.00
R0926:Gapvd1 UTSW 2 34712325 missense probably damaging 1.00
R0970:Gapvd1 UTSW 2 34730613 unclassified probably null
R1168:Gapvd1 UTSW 2 34704469 missense probably damaging 1.00
R1391:Gapvd1 UTSW 2 34706802 missense probably damaging 1.00
R1577:Gapvd1 UTSW 2 34709228 missense probably damaging 1.00
R1585:Gapvd1 UTSW 2 34712195 missense possibly damaging 0.93
R1669:Gapvd1 UTSW 2 34730682 critical splice acceptor site probably null
R1677:Gapvd1 UTSW 2 34700761 critical splice donor site probably null
R1812:Gapvd1 UTSW 2 34725064 nonsense probably null
R1874:Gapvd1 UTSW 2 34706021 missense probably damaging 1.00
R1878:Gapvd1 UTSW 2 34725200 missense probably benign 0.00
R1974:Gapvd1 UTSW 2 34700841 missense probably damaging 0.99
R2111:Gapvd1 UTSW 2 34684317 missense probably benign 0.08
R2921:Gapvd1 UTSW 2 34688863 missense probably damaging 0.97
R2923:Gapvd1 UTSW 2 34688863 missense probably damaging 0.97
R3846:Gapvd1 UTSW 2 34729072 nonsense probably null
R3894:Gapvd1 UTSW 2 34728476 missense probably benign 0.23
R4405:Gapvd1 UTSW 2 34728735 missense probably damaging 1.00
R4605:Gapvd1 UTSW 2 34728537 missense probably damaging 1.00
R4770:Gapvd1 UTSW 2 34691181 missense probably damaging 0.98
R4935:Gapvd1 UTSW 2 34704492 nonsense probably null
R5218:Gapvd1 UTSW 2 34728476 missense probably benign 0.23
R5490:Gapvd1 UTSW 2 34693433 missense probably benign 0.23
R5571:Gapvd1 UTSW 2 34715253 missense probably damaging 1.00
R5588:Gapvd1 UTSW 2 34709154 missense probably damaging 1.00
R5933:Gapvd1 UTSW 2 34684291 missense probably benign 0.27
R6117:Gapvd1 UTSW 2 34690459 splice site probably null
R6661:Gapvd1 UTSW 2 34728438 missense probably damaging 1.00
R6857:Gapvd1 UTSW 2 34728377 missense probably damaging 1.00
R6950:Gapvd1 UTSW 2 34684245 missense probably benign 0.04
R7009:Gapvd1 UTSW 2 34700817 missense probably damaging 1.00
R7125:Gapvd1 UTSW 2 34695600 missense probably benign
R7154:Gapvd1 UTSW 2 34725063 missense probably damaging 1.00
R7316:Gapvd1 UTSW 2 34704669 missense probably damaging 1.00
R7358:Gapvd1 UTSW 2 34690461 critical splice donor site probably null
R7363:Gapvd1 UTSW 2 34712195 missense probably benign 0.01
R7371:Gapvd1 UTSW 2 34717373 missense probably benign
R7418:Gapvd1 UTSW 2 34725118 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GATCTGTTTCCTGGCTACAGTCTGC -3'
(R):5'- GATGTGCTCCACCATCATGAACCTC -3'

Sequencing Primer
(F):5'- GGCTACAGTCTGCTGTCTTG -3'
(R):5'- ATCATGAACCTCTTGAGCCTGG -3'
Posted On2013-06-11