Incidental Mutation 'R5773:Stxbp5l'
ID445532
Institutional Source Beutler Lab
Gene Symbol Stxbp5l
Ensembl Gene ENSMUSG00000022829
Gene Namesyntaxin binding protein 5-like
Synonymst2md1, insulin level locus 1, tomosyn-2, T2dm1, A830015P08Rik, LLGL4
MMRRC Submission 043372-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5773 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location37114942-37384962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37208097 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 535 (A535S)
Ref Sequence ENSEMBL: ENSMUSP00000110435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023526] [ENSMUST00000114780] [ENSMUST00000114781] [ENSMUST00000114782] [ENSMUST00000114787]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000023526
SMART Domains Protein: ENSMUSP00000023526
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 2e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 7.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
low complexity region 790 804 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114780
AA Change: A535S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110428
Gene: ENSMUSG00000022829
AA Change: A535S

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 731 988 3e-9 PFAM
PDB:1URQ|A 1038 1097 2e-25 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000114781
AA Change: A535S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110429
Gene: ENSMUSG00000022829
AA Change: A535S

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.9e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 755 1012 3.1e-9 PFAM
PDB:1URQ|A 1062 1121 2e-25 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000114782
AA Change: A535S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110430
Gene: ENSMUSG00000022829
AA Change: A535S

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 9.2e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 785 1045 3.1e-9 PFAM
PDB:1URQ|A 1095 1154 2e-25 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000114787
AA Change: A535S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110435
Gene: ENSMUSG00000022829
AA Change: A535S

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 287 396 8.7e-35 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 811 1069 3.3e-9 PFAM
PDB:1URQ|A 1119 1178 2e-25 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149984
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to syntaxin-binding protein 5 and contains ten N-terminal WD40 repeats, four variable region WD40 repeats, and a C-terminal R-SNARE domain. Studies of the orthologous proteins in mouse and rat have shown that the encoded protein may inhibit exocytosis in neurosecretory cells, and may negatively regulate the secretion of insulin. A missense variant in this gene is likely the cause of an infantile-onset neurodegenerative disorder diagnosed in two siblings of consanguineous parents. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a QTL derived from BTBR exhibit increased fasting serum glucose and decreased fasting serum insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 G A 2: 155,574,694 probably null Het
Akna C T 4: 63,395,070 S272N probably benign Het
Ap2m1 T C 16: 20,543,390 V416A probably damaging Het
Atp7b A G 8: 22,027,863 F320L probably benign Het
Brd1 T C 15: 88,689,549 K1116E probably benign Het
Ccdc186 T C 19: 56,813,487 D66G probably benign Het
Cdh4 A G 2: 179,885,996 Y503C probably damaging Het
Cfb C A 17: 34,857,272 E166* probably null Het
Cmtm1 A T 8: 104,305,176 F90I probably damaging Het
Col1a1 A T 11: 94,939,429 K160N probably benign Het
Cradd T C 10: 95,175,961 I106V probably benign Het
Defa17 A G 8: 21,656,558 R67G probably damaging Het
Dgkh T C 14: 78,595,455 N765S probably damaging Het
Dock5 A G 14: 67,796,058 V954A possibly damaging Het
Eif2d A G 1: 131,158,303 probably null Het
Epg5 T A 18: 77,960,825 F683I probably damaging Het
Fhad1 T G 4: 141,929,570 K91T probably damaging Het
Fut11 A T 14: 20,698,315 D476V probably damaging Het
Gldn T C 9: 54,334,491 probably null Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm8674 T A 13: 49,901,876 noncoding transcript Het
Gtpbp6 C A 5: 110,106,891 E168D possibly damaging Het
Hinfp T A 9: 44,299,236 H163L probably benign Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Ing3 T A 6: 21,971,835 C368S probably damaging Het
Itih1 A G 14: 30,935,399 V489A possibly damaging Het
Itsn2 T C 12: 4,707,089 L1393P probably damaging Het
Kcnj13 T C 1: 87,386,667 T278A probably damaging Het
Kntc1 G A 5: 123,794,157 R1338Q probably damaging Het
Lipi T A 16: 75,573,925 T135S probably damaging Het
Map7 A G 10: 20,246,644 K152R probably benign Het
Mmp24 A G 2: 155,799,909 Y219C probably damaging Het
Nup188 T C 2: 30,322,196 V565A possibly damaging Het
Nup210 T C 6: 91,085,883 K265E probably damaging Het
Olfr1331 A G 4: 118,869,521 T247A probably damaging Het
Pcdha6 A T 18: 36,969,590 H612L probably benign Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pld2 G T 11: 70,555,932 S778I probably damaging Het
Ppef2 A C 5: 92,250,561 Y33D probably damaging Het
Ppfibp2 A T 7: 107,685,872 T129S possibly damaging Het
Prickle1 G T 15: 93,508,597 H182N probably damaging Het
R3hdm2 T A 10: 127,444,303 probably benign Het
Rbm12b1 A T 4: 12,145,765 E579V probably damaging Het
Rsf1 GGC GGCGGCGGCTGC 7: 97,579,933 probably benign Het
Slc1a6 T G 10: 78,793,277 probably null Het
Slc27a6 G T 18: 58,582,173 A283S probably damaging Het
Spats2l T A 1: 57,879,549 N27K possibly damaging Het
Srgap1 T C 10: 121,896,709 M155V probably benign Het
Svep1 C A 4: 58,099,985 C1353F possibly damaging Het
Taar4 T A 10: 23,961,158 I222N probably damaging Het
Tlr6 A G 5: 64,954,503 F354L probably benign Het
Trp53bp1 A G 2: 121,243,914 S452P probably damaging Het
Ttll5 GCCCTGCGGGGCTGCCACGCTGTCGATCCGGCAGCTAC G 12: 85,933,555 probably null Het
Usp42 A T 5: 143,713,712 M1264K probably benign Het
Zfp865 A T 7: 5,034,694 probably benign Het
Zfyve26 A T 12: 79,287,737 L169Q probably damaging Het
Zmym4 A T 4: 126,905,370 N383K possibly damaging Het
Other mutations in Stxbp5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stxbp5l APN 16 37208100 missense possibly damaging 0.82
IGL01082:Stxbp5l APN 16 37204578 missense possibly damaging 0.89
IGL01448:Stxbp5l APN 16 37215979 missense probably damaging 0.99
IGL01475:Stxbp5l APN 16 37345092 missense possibly damaging 0.95
IGL01899:Stxbp5l APN 16 37200592 missense probably benign 0.19
IGL02232:Stxbp5l APN 16 37329895 missense probably damaging 1.00
IGL02389:Stxbp5l APN 16 37208205 missense probably benign 0.00
IGL02745:Stxbp5l APN 16 37186654 nonsense probably null
IGL03125:Stxbp5l APN 16 37186721 missense probably benign 0.02
R0058:Stxbp5l UTSW 16 37142374 missense possibly damaging 0.76
R0345:Stxbp5l UTSW 16 37288308 missense probably damaging 1.00
R0359:Stxbp5l UTSW 16 37216078 splice site probably benign
R0454:Stxbp5l UTSW 16 37134284 missense possibly damaging 0.94
R0525:Stxbp5l UTSW 16 37129797 critical splice donor site probably null
R0543:Stxbp5l UTSW 16 37208096 missense probably damaging 1.00
R0606:Stxbp5l UTSW 16 37204521 missense possibly damaging 0.46
R0607:Stxbp5l UTSW 16 37142432 missense probably benign 0.00
R1333:Stxbp5l UTSW 16 37247869 critical splice donor site probably null
R1593:Stxbp5l UTSW 16 37116052 missense probably damaging 0.96
R1605:Stxbp5l UTSW 16 37208111 missense probably benign 0.34
R1670:Stxbp5l UTSW 16 37290927 critical splice donor site probably null
R2077:Stxbp5l UTSW 16 37236275 missense possibly damaging 0.93
R2209:Stxbp5l UTSW 16 37216036 missense probably damaging 0.98
R2504:Stxbp5l UTSW 16 37115667 missense probably damaging 1.00
R2909:Stxbp5l UTSW 16 37208186 missense possibly damaging 0.89
R2917:Stxbp5l UTSW 16 37200642 nonsense probably null
R2918:Stxbp5l UTSW 16 37200642 nonsense probably null
R2935:Stxbp5l UTSW 16 37134189 missense possibly damaging 0.76
R3693:Stxbp5l UTSW 16 37241346 nonsense probably null
R3694:Stxbp5l UTSW 16 37241346 nonsense probably null
R3695:Stxbp5l UTSW 16 37241346 nonsense probably null
R4133:Stxbp5l UTSW 16 37208119 missense possibly damaging 0.80
R4180:Stxbp5l UTSW 16 37247880 missense probably benign 0.05
R4676:Stxbp5l UTSW 16 37255884 missense probably damaging 1.00
R4757:Stxbp5l UTSW 16 37188634 missense probably damaging 1.00
R4758:Stxbp5l UTSW 16 37134230 missense probably benign 0.18
R5105:Stxbp5l UTSW 16 37142372 missense probably benign 0.43
R5278:Stxbp5l UTSW 16 37186654 missense probably benign 0.19
R5358:Stxbp5l UTSW 16 37174326 missense probably damaging 0.99
R5411:Stxbp5l UTSW 16 37129851 missense probably damaging 1.00
R6539:Stxbp5l UTSW 16 37129815 missense probably damaging 1.00
R6869:Stxbp5l UTSW 16 37204448 missense possibly damaging 0.74
R6892:Stxbp5l UTSW 16 37188629 missense possibly damaging 0.94
R7369:Stxbp5l UTSW 16 37134341 missense probably benign 0.12
R7555:Stxbp5l UTSW 16 37323603 missense probably damaging 1.00
R7657:Stxbp5l UTSW 16 37210172 missense probably null 0.21
Z1088:Stxbp5l UTSW 16 37204489 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATTACAGTAGACAGCAAAGC -3'
(R):5'- GAGCACTTCACTGAGGGATTACTATG -3'

Sequencing Primer
(F):5'- TTACAGTAGACAGCAAAGCCAAAC -3'
(R):5'- CACTGAGGGATTACTATGTAAATGTC -3'
Posted On2016-11-21