Incidental Mutation 'R5774:Man2a2'
ID 445558
Institutional Source Beutler Lab
Gene Symbol Man2a2
Ensembl Gene ENSMUSG00000038886
Gene Name mannosidase 2, alpha 2
Synonyms alpha mannosidase IIx, 1700052O22Rik, MX, 4931438M07Rik
MMRRC Submission 043373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock # R5774 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 80349097-80371375 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80368358 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 188 (Y188C)
Ref Sequence ENSEMBL: ENSMUSP00000145861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098346] [ENSMUST00000205436] [ENSMUST00000206212] [ENSMUST00000206301]
AlphaFold Q8BRK9
Predicted Effect probably damaging
Transcript: ENSMUST00000098346
AA Change: Y188C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095949
Gene: ENSMUSG00000038886
AA Change: Y188C

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_hydro_38 167 497 1.9e-109 PFAM
Alpha-mann_mid 502 588 1.4e-32 SMART
Pfam:Glyco_hydro_38C 648 1148 1.1e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205318
Predicted Effect probably benign
Transcript: ENSMUST00000205436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205535
Predicted Effect probably benign
Transcript: ENSMUST00000205853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206066
Predicted Effect probably benign
Transcript: ENSMUST00000206212
Predicted Effect probably damaging
Transcript: ENSMUST00000206301
AA Change: Y188C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206917
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null males are infertile due to a defect during spermatogenesis involving the premature release of germ cells from the seminiferous tubules into the epididymis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,531,667 L62M probably damaging Het
Abcc9 G A 6: 142,628,559 T949I probably damaging Het
Adam4 C T 12: 81,420,686 S387N probably damaging Het
Akap11 T C 14: 78,510,967 S1327G probably damaging Het
Arhgap1 A G 2: 91,654,108 T12A possibly damaging Het
Arhgap28 A G 17: 67,881,492 S228P possibly damaging Het
Atp6v1b2 A T 8: 69,101,961 D106V probably damaging Het
Atp9b T G 18: 80,933,932 D3A probably damaging Het
BC030867 T A 11: 102,255,669 I257N possibly damaging Het
Bptf A G 11: 107,111,137 F383S probably damaging Het
Cdh24 T C 14: 54,639,057 T104A probably damaging Het
Cep55 A G 19: 38,062,655 E171G probably damaging Het
Cntrl T A 2: 35,162,861 M1126K probably benign Het
Cts3 A T 13: 61,568,370 I59N probably damaging Het
Ddx52 A G 11: 83,946,134 I150M probably damaging Het
Dennd6a T C 14: 26,579,819 V62A probably benign Het
Dpep1 C A 8: 123,199,982 D211E probably damaging Het
Gm1527 T C 3: 28,918,090 V452A probably benign Het
Hmcn2 T C 2: 31,409,135 V2831A possibly damaging Het
Hydin G T 8: 110,571,915 E3722* probably null Het
Il17a A G 1: 20,733,773 S131G probably benign Het
Ing3 C T 6: 21,967,689 P119S probably benign Het
Larp4b T A 13: 9,170,643 probably null Het
Lca5l G T 16: 96,176,061 Q177K probably benign Het
Lrrc61 C T 6: 48,568,199 probably benign Het
Mdk T C 2: 91,931,224 E36G probably damaging Het
Mmp12 T C 9: 7,354,823 I272T possibly damaging Het
Myh4 A T 11: 67,253,208 K1135* probably null Het
Nup188 T A 2: 30,301,048 Y96N probably damaging Het
Olfr1080 A T 2: 86,554,007 V39E possibly damaging Het
Pank4 G A 4: 154,980,662 G806D probably damaging Het
Parp14 T C 16: 35,858,410 Y396C probably damaging Het
Pcdhb8 T A 18: 37,356,685 I472N probably damaging Het
Sema3a T A 5: 13,523,164 W220R probably damaging Het
Slc35g3 A G 11: 69,760,298 V309A probably damaging Het
Slc6a6 A G 6: 91,745,000 M394V probably damaging Het
Specc1l G A 10: 75,245,400 R210H probably damaging Het
Spocd1 T A 4: 129,951,786 S480T probably benign Het
Sptbn5 T A 2: 120,050,458 noncoding transcript Het
Srrm2 A G 17: 23,818,275 probably benign Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Topbp1 A G 9: 103,328,499 K779E probably benign Het
Trank1 T A 9: 111,391,226 F2344I probably damaging Het
Ttll5 GCCCTGCGGGGCTGCCACGCTGTCGATCCGGCAGCTAC G 12: 85,933,555 probably null Het
Ube4a G A 9: 44,953,097 P66L probably damaging Het
Utp6 A T 11: 79,953,598 F200L probably benign Het
Vmn2r117 A T 17: 23,477,202 H410Q probably damaging Het
Vps33b C T 7: 80,285,340 H344Y probably benign Het
Xpo5 C T 17: 46,241,846 R1145* probably null Het
Zbed4 T A 15: 88,781,649 F640Y possibly damaging Het
Zfp618 C T 4: 63,132,562 R527C probably damaging Het
Other mutations in Man2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Man2a2 APN 7 80361132 missense possibly damaging 0.94
IGL01405:Man2a2 APN 7 80360934 missense probably benign 0.00
IGL01717:Man2a2 APN 7 80367365 missense probably damaging 1.00
IGL01843:Man2a2 APN 7 80362906 missense probably benign
IGL02212:Man2a2 APN 7 80362308 missense probably benign 0.00
IGL02383:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02434:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02493:Man2a2 APN 7 80369615 missense possibly damaging 0.68
IGL02528:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02529:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02530:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02534:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02869:Man2a2 APN 7 80363941 missense probably benign 0.00
IGL03084:Man2a2 APN 7 80352943 missense possibly damaging 0.88
IGL03088:Man2a2 APN 7 80359334 missense possibly damaging 0.91
IGL03377:Man2a2 APN 7 80359052 splice site probably null
IGL03412:Man2a2 APN 7 80366998 missense probably damaging 1.00
dugong UTSW 7 80360921 missense probably benign 0.12
R2090_Man2a2_705 UTSW 7 80364110 unclassified probably benign
R7828_Man2a2_437 UTSW 7 80366926 missense probably damaging 0.98
R0112:Man2a2 UTSW 7 80358276 missense probably damaging 0.99
R0119:Man2a2 UTSW 7 80367405 missense probably damaging 1.00
R0646:Man2a2 UTSW 7 80363197 missense possibly damaging 0.53
R1184:Man2a2 UTSW 7 80362965 missense possibly damaging 0.79
R1445:Man2a2 UTSW 7 80368562 missense probably benign 0.06
R1626:Man2a2 UTSW 7 80367702 missense probably damaging 1.00
R1739:Man2a2 UTSW 7 80362438 missense probably benign 0.10
R1820:Man2a2 UTSW 7 80358933 missense probably benign 0.22
R2090:Man2a2 UTSW 7 80364110 unclassified probably benign
R2144:Man2a2 UTSW 7 80363516 missense probably damaging 1.00
R2150:Man2a2 UTSW 7 80367784 missense probably damaging 1.00
R3882:Man2a2 UTSW 7 80362315 missense possibly damaging 0.70
R4181:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4285:Man2a2 UTSW 7 80368619 missense probably damaging 1.00
R4302:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4440:Man2a2 UTSW 7 80351715 missense probably benign 0.37
R4494:Man2a2 UTSW 7 80359275 splice site probably null
R4564:Man2a2 UTSW 7 80368838 missense probably benign 0.00
R4631:Man2a2 UTSW 7 80362463 missense probably benign 0.10
R5328:Man2a2 UTSW 7 80368756 missense probably benign 0.06
R5329:Man2a2 UTSW 7 80361128 missense possibly damaging 0.82
R5468:Man2a2 UTSW 7 80352981 missense probably damaging 0.98
R5824:Man2a2 UTSW 7 80353032 missense probably benign 0.00
R5915:Man2a2 UTSW 7 80360921 missense probably benign 0.12
R5937:Man2a2 UTSW 7 80363503 missense probably damaging 1.00
R6101:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6105:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6481:Man2a2 UTSW 7 80364071 missense probably damaging 0.99
R6592:Man2a2 UTSW 7 80353199 missense probably damaging 0.98
R6869:Man2a2 UTSW 7 80362945 missense probably benign 0.35
R6918:Man2a2 UTSW 7 80353192 missense possibly damaging 0.91
R7137:Man2a2 UTSW 7 80359751 missense probably benign 0.19
R7236:Man2a2 UTSW 7 80368905 missense probably damaging 1.00
R7496:Man2a2 UTSW 7 80352997 missense probably damaging 1.00
R7522:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7523:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7524:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7583:Man2a2 UTSW 7 80366944 missense probably damaging 1.00
R7681:Man2a2 UTSW 7 80351749 missense possibly damaging 0.49
R7828:Man2a2 UTSW 7 80366926 missense probably damaging 0.98
R7843:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7845:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7847:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7848:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7984:Man2a2 UTSW 7 80353308 missense probably damaging 0.99
R8194:Man2a2 UTSW 7 80361018 missense probably benign
R8296:Man2a2 UTSW 7 80368908 missense probably damaging 0.99
R8376:Man2a2 UTSW 7 80360923 nonsense probably null
R8515:Man2a2 UTSW 7 80368290 missense possibly damaging 0.88
R8842:Man2a2 UTSW 7 80353319 missense probably damaging 1.00
R9205:Man2a2 UTSW 7 80361120 missense probably benign
R9563:Man2a2 UTSW 7 80356353 missense probably benign
X0057:Man2a2 UTSW 7 80362324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGCCACACAATGAGAC -3'
(R):5'- CAAGTGTTTGTGGTGCCTCAC -3'

Sequencing Primer
(F):5'- GAGTCCTAGATAATGATCGACCTTCC -3'
(R):5'- CTCCCACAACGATCCAGGTG -3'
Posted On 2016-11-21