Incidental Mutation 'R5774:Topbp1'
ID445566
Institutional Source Beutler Lab
Gene Symbol Topbp1
Ensembl Gene ENSMUSG00000032555
Gene Nametopoisomerase (DNA) II binding protein 1
SynonymsD430026L04Rik, 2810429C13Rik, 1110031N14Rik
MMRRC Submission 043373-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5774 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location103305215-103350428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103328499 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 779 (K779E)
Ref Sequence ENSEMBL: ENSMUSP00000035164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035164]
Predicted Effect probably benign
Transcript: ENSMUST00000035164
AA Change: K779E

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000035164
Gene: ENSMUSG00000032555
AA Change: K779E

DomainStartEndE-ValueType
BRCT 6 91 3.04e1 SMART
BRCT 103 179 1.51e-13 SMART
BRCT 197 274 4.69e-19 SMART
BRCT 355 433 3.58e-15 SMART
BRCT 553 626 5.57e-3 SMART
BRCT 646 731 1.53e-9 SMART
BRCT 904 983 3.48e-13 SMART
low complexity region 1097 1106 N/A INTRINSIC
low complexity region 1110 1121 N/A INTRINSIC
low complexity region 1213 1218 N/A INTRINSIC
BRCT 1258 1337 2.31e-9 SMART
Blast:BRCT 1387 1472 4e-52 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000185721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188840
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a binding protein which interacts with the C-terminal region of topoisomerase II beta. This interaction suggests a supportive role for this protein in the catalytic reactions of topoisomerase II beta through transient breakages of DNA strands. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die around implantation due to embryonic growth arrest, increased apoptosis, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,531,667 L62M probably damaging Het
Abcc9 G A 6: 142,628,559 T949I probably damaging Het
Adam4 C T 12: 81,420,686 S387N probably damaging Het
Akap11 T C 14: 78,510,967 S1327G probably damaging Het
Arhgap1 A G 2: 91,654,108 T12A possibly damaging Het
Arhgap28 A G 17: 67,881,492 S228P possibly damaging Het
Atp6v1b2 A T 8: 69,101,961 D106V probably damaging Het
Atp9b T G 18: 80,933,932 D3A probably damaging Het
BC030867 T A 11: 102,255,669 I257N possibly damaging Het
Bptf A G 11: 107,111,137 F383S probably damaging Het
Cdh24 T C 14: 54,639,057 T104A probably damaging Het
Cep55 A G 19: 38,062,655 E171G probably damaging Het
Cntrl T A 2: 35,162,861 M1126K probably benign Het
Cts3 A T 13: 61,568,370 I59N probably damaging Het
Ddx52 A G 11: 83,946,134 I150M probably damaging Het
Dennd6a T C 14: 26,579,819 V62A probably benign Het
Dpep1 C A 8: 123,199,982 D211E probably damaging Het
Gm1527 T C 3: 28,918,090 V452A probably benign Het
Hmcn2 T C 2: 31,409,135 V2831A possibly damaging Het
Hydin G T 8: 110,571,915 E3722* probably null Het
Il17a A G 1: 20,733,773 S131G probably benign Het
Ing3 C T 6: 21,967,689 P119S probably benign Het
Larp4b T A 13: 9,170,643 probably null Het
Lca5l G T 16: 96,176,061 Q177K probably benign Het
Lrrc61 C T 6: 48,568,199 probably benign Het
Man2a2 T C 7: 80,368,358 Y188C probably damaging Het
Mdk T C 2: 91,931,224 E36G probably damaging Het
Mmp12 T C 9: 7,354,823 I272T possibly damaging Het
Myh4 A T 11: 67,253,208 K1135* probably null Het
Nup188 T A 2: 30,301,048 Y96N probably damaging Het
Olfr1080 A T 2: 86,554,007 V39E possibly damaging Het
Pank4 G A 4: 154,980,662 G806D probably damaging Het
Parp14 T C 16: 35,858,410 Y396C probably damaging Het
Pcdhb8 T A 18: 37,356,685 I472N probably damaging Het
Sema3a T A 5: 13,523,164 W220R probably damaging Het
Slc35g3 A G 11: 69,760,298 V309A probably damaging Het
Slc6a6 A G 6: 91,745,000 M394V probably damaging Het
Specc1l G A 10: 75,245,400 R210H probably damaging Het
Spocd1 T A 4: 129,951,786 S480T probably benign Het
Sptbn5 T A 2: 120,050,458 noncoding transcript Het
Srrm2 A G 17: 23,818,275 probably benign Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Trank1 T A 9: 111,391,226 F2344I probably damaging Het
Ttll5 GCCCTGCGGGGCTGCCACGCTGTCGATCCGGCAGCTAC G 12: 85,933,555 probably null Het
Ube4a G A 9: 44,953,097 P66L probably damaging Het
Utp6 A T 11: 79,953,598 F200L probably benign Het
Vmn2r117 A T 17: 23,477,202 H410Q probably damaging Het
Vps33b C T 7: 80,285,340 H344Y probably benign Het
Xpo5 C T 17: 46,241,846 R1145* probably null Het
Zbed4 T A 15: 88,781,649 F640Y possibly damaging Het
Zfp618 C T 4: 63,132,562 R527C probably damaging Het
Other mutations in Topbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Topbp1 APN 9 103344943 missense probably benign
IGL01524:Topbp1 APN 9 103311645 missense possibly damaging 0.92
IGL02335:Topbp1 APN 9 103328523 missense probably damaging 1.00
IGL02441:Topbp1 APN 9 103320239 missense possibly damaging 0.49
IGL02943:Topbp1 APN 9 103328440 missense probably benign 0.00
IGL02953:Topbp1 APN 9 103328435 missense probably benign 0.26
IGL03040:Topbp1 APN 9 103328667 missense possibly damaging 0.51
PIT4377001:Topbp1 UTSW 9 103309889 missense possibly damaging 0.90
R0044:Topbp1 UTSW 9 103325773 missense possibly damaging 0.94
R0344:Topbp1 UTSW 9 103328687 missense probably damaging 0.99
R0344:Topbp1 UTSW 9 103308733 splice site probably benign
R0591:Topbp1 UTSW 9 103349838 missense probably benign 0.01
R0666:Topbp1 UTSW 9 103308812 missense probably benign
R0785:Topbp1 UTSW 9 103315090 missense probably damaging 1.00
R0906:Topbp1 UTSW 9 103328593 missense probably benign 0.00
R1352:Topbp1 UTSW 9 103347008 missense probably benign
R1745:Topbp1 UTSW 9 103308845 missense probably benign 0.36
R2104:Topbp1 UTSW 9 103317982 splice site probably benign
R2166:Topbp1 UTSW 9 103312929 splice site probably null
R2230:Topbp1 UTSW 9 103345848 missense probably damaging 1.00
R2967:Topbp1 UTSW 9 103342140 missense probably benign 0.01
R3845:Topbp1 UTSW 9 103309923 missense possibly damaging 0.87
R4089:Topbp1 UTSW 9 103324501 critical splice donor site probably null
R4110:Topbp1 UTSW 9 103309959 missense probably damaging 0.98
R4454:Topbp1 UTSW 9 103344871 missense probably damaging 1.00
R4521:Topbp1 UTSW 9 103334202 intron probably benign
R4745:Topbp1 UTSW 9 103323571 missense probably damaging 1.00
R4923:Topbp1 UTSW 9 103312836 missense probably benign 0.00
R4934:Topbp1 UTSW 9 103328369 unclassified probably benign
R4963:Topbp1 UTSW 9 103320605 missense probably benign 0.04
R5199:Topbp1 UTSW 9 103346672 unclassified probably benign
R5461:Topbp1 UTSW 9 103315196 missense probably benign 0.00
R5517:Topbp1 UTSW 9 103336114 missense probably benign 0.03
R5563:Topbp1 UTSW 9 103311513 missense possibly damaging 0.46
R5564:Topbp1 UTSW 9 103334078 missense probably damaging 1.00
R5683:Topbp1 UTSW 9 103312804 missense possibly damaging 0.93
R5785:Topbp1 UTSW 9 103323528 missense probably benign 0.00
R6029:Topbp1 UTSW 9 103344953 missense probably benign 0.00
R6077:Topbp1 UTSW 9 103332990 missense probably damaging 1.00
R6122:Topbp1 UTSW 9 103346961 missense probably benign 0.06
R6133:Topbp1 UTSW 9 103311764 splice site probably null
R6213:Topbp1 UTSW 9 103332751 missense probably benign 0.12
R6773:Topbp1 UTSW 9 103343692 missense possibly damaging 0.90
R6922:Topbp1 UTSW 9 103335846 missense probably damaging 1.00
R6938:Topbp1 UTSW 9 103328554 missense probably damaging 1.00
R7305:Topbp1 UTSW 9 103328637 missense probably damaging 1.00
R7419:Topbp1 UTSW 9 103323344 missense probably benign
R7517:Topbp1 UTSW 9 103332733 missense possibly damaging 0.82
R7605:Topbp1 UTSW 9 103332706 missense probably benign 0.41
R7701:Topbp1 UTSW 9 103332985 missense probably damaging 0.96
R7741:Topbp1 UTSW 9 103320557 missense probably damaging 0.97
R8115:Topbp1 UTSW 9 103320541 missense probably benign
R8177:Topbp1 UTSW 9 103320541 missense probably benign 0.01
R8269:Topbp1 UTSW 9 103328593 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TTGCCTCATATGAGAGAAAAGGCTC -3'
(R):5'- TGGGGCTCTACCTTTATAAACC -3'

Sequencing Primer
(F):5'- GAGAAAAGGCTCATATTAATGGCTC -3'
(R):5'- AGTAACATTTCCTTCAAACCTTACCG -3'
Posted On2016-11-21