Mutagenetix > Incidental Mutation

Incidental Mutation 'R5774:Vmn2r117'

445587

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r117

Ensembl Gene

ENSMUSG00000091407

Gene Name

vomeronasal 2, receptor 117

Synonyms

EG619788

MMRRC Submission

043373-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R5774 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23459675-23479597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 23477202 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 410 (H410Q)

Ref Sequence

ENSEMBL: ENSMUSP00000126885 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171996]

AlphaFold

K7N6V1

Predicted Effect

probably damaging
Transcript: ENSMUST00000171996
AA Change: H410Q

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: H410Q

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	471	2.6e-28	PFAM
Pfam:NCD3G	512	565	5e-20	PFAM
Pfam:7tm_3	595	833	8.2e-54	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730507C01Rik	C	A	12: 18,531,667	L62M	probably damaging	Het
Abcc9	G	A	6: 142,628,559	T949I	probably damaging	Het
Adam4	C	T	12: 81,420,686	S387N	probably damaging	Het
Akap11	T	C	14: 78,510,967	S1327G	probably damaging	Het
Arhgap1	A	G	2: 91,654,108	T12A	possibly damaging	Het
Arhgap28	A	G	17: 67,881,492	S228P	possibly damaging	Het
Atp6v1b2	A	T	8: 69,101,961	D106V	probably damaging	Het
Atp9b	T	G	18: 80,933,932	D3A	probably damaging	Het
BC030867	T	A	11: 102,255,669	I257N	possibly damaging	Het
Bptf	A	G	11: 107,111,137	F383S	probably damaging	Het
Cdh24	T	C	14: 54,639,057	T104A	probably damaging	Het
Cep55	A	G	19: 38,062,655	E171G	probably damaging	Het
Cntrl	T	A	2: 35,162,861	M1126K	probably benign	Het
Cts3	A	T	13: 61,568,370	I59N	probably damaging	Het
Ddx52	A	G	11: 83,946,134	I150M	probably damaging	Het
Dennd6a	T	C	14: 26,579,819	V62A	probably benign	Het
Dpep1	C	A	8: 123,199,982	D211E	probably damaging	Het
Gm1527	T	C	3: 28,918,090	V452A	probably benign	Het
Hmcn2	T	C	2: 31,409,135	V2831A	possibly damaging	Het
Hydin	G	T	8: 110,571,915	E3722*	probably null	Het
Il17a	A	G	1: 20,733,773	S131G	probably benign	Het
Ing3	C	T	6: 21,967,689	P119S	probably benign	Het
Larp4b	T	A	13: 9,170,643		probably null	Het
Lca5l	G	T	16: 96,176,061	Q177K	probably benign	Het
Lrrc61	C	T	6: 48,568,199		probably benign	Het
Man2a2	T	C	7: 80,368,358	Y188C	probably damaging	Het
Mdk	T	C	2: 91,931,224	E36G	probably damaging	Het
Mmp12	T	C	9: 7,354,823	I272T	possibly damaging	Het
Myh4	A	T	11: 67,253,208	K1135*	probably null	Het
Nup188	T	A	2: 30,301,048	Y96N	probably damaging	Het
Olfr1080	A	T	2: 86,554,007	V39E	possibly damaging	Het
Pank4	G	A	4: 154,980,662	G806D	probably damaging	Het
Parp14	T	C	16: 35,858,410	Y396C	probably damaging	Het
Pcdhb8	T	A	18: 37,356,685	I472N	probably damaging	Het
Sema3a	T	A	5: 13,523,164	W220R	probably damaging	Het
Slc35g3	A	G	11: 69,760,298	V309A	probably damaging	Het
Slc6a6	A	G	6: 91,745,000	M394V	probably damaging	Het
Specc1l	G	A	10: 75,245,400	R210H	probably damaging	Het
Spocd1	T	A	4: 129,951,786	S480T	probably benign	Het
Sptbn5	T	A	2: 120,050,458		noncoding transcript	Het
Srrm2	A	G	17: 23,818,275		probably benign	Het
Stx16	G	A	2: 174,093,499	G156R	probably damaging	Het
Topbp1	A	G	9: 103,328,499	K779E	probably benign	Het
Trank1	T	A	9: 111,391,226	F2344I	probably damaging	Het
Ttll5	GCCCTGCGGGGCTGCCACGCTGTCGATCCGGCAGCTAC	G	12: 85,933,555		probably null	Het
Ube4a	G	A	9: 44,953,097	P66L	probably damaging	Het
Utp6	A	T	11: 79,953,598	F200L	probably benign	Het
Vps33b	C	T	7: 80,285,340	H344Y	probably benign	Het
Xpo5	C	T	17: 46,241,846	R1145*	probably null	Het
Zbed4	T	A	15: 88,781,649	F640Y	possibly damaging	Het
Zfp618	C	T	4: 63,132,562	R527C	probably damaging	Het

Other mutations in Vmn2r117

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Vmn2r117	APN	17	23477840	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23475429	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23479546	missense	probably benign
IGL01078:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01139:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01374:Vmn2r117	APN	17	23478382	missense	possibly damaging	0.46
IGL01779:Vmn2r117	APN	17	23477241	missense	probably benign	0.00
IGL02283:Vmn2r117	APN	17	23475382	missense	probably damaging	0.99
IGL02527:Vmn2r117	APN	17	23477225	missense	possibly damaging	0.65
IGL02612:Vmn2r117	APN	17	23459784	missense	possibly damaging	0.91
IGL02887:Vmn2r117	APN	17	23475578	splice site	probably benign
IGL03167:Vmn2r117	APN	17	23477707	missense	probably damaging	1.00
R0315:Vmn2r117	UTSW	17	23460165	missense	probably benign	0.11
R0610:Vmn2r117	UTSW	17	23475514	missense	probably benign	0.00
R0747:Vmn2r117	UTSW	17	23475503	nonsense	probably null
R1411:Vmn2r117	UTSW	17	23460553	missense	probably damaging	1.00
R1471:Vmn2r117	UTSW	17	23478473	missense	probably benign	0.00
R1853:Vmn2r117	UTSW	17	23477455	missense	probably damaging	0.99
R1925:Vmn2r117	UTSW	17	23478389	missense	probably benign	0.00
R1940:Vmn2r117	UTSW	17	23477480	missense	probably damaging	1.00
R2005:Vmn2r117	UTSW	17	23477644	missense	probably damaging	1.00
R2082:Vmn2r117	UTSW	17	23460256	missense	possibly damaging	0.55
R2698:Vmn2r117	UTSW	17	23459911	missense	probably damaging	0.98
R2972:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2973:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2974:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R3160:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3161:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3162:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3847:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R3848:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R4082:Vmn2r117	UTSW	17	23460106	missense	probably benign	0.00
R4320:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R4560:Vmn2r117	UTSW	17	23459877	missense	probably damaging	1.00
R4658:Vmn2r117	UTSW	17	23478416	missense	probably benign	0.01
R4881:Vmn2r117	UTSW	17	23477885	missense	probably damaging	1.00
R4908:Vmn2r117	UTSW	17	23459838	missense	probably damaging	1.00
R4910:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R5078:Vmn2r117	UTSW	17	23460148	missense	probably damaging	1.00
R5327:Vmn2r117	UTSW	17	23477874	nonsense	probably null
R6014:Vmn2r117	UTSW	17	23479561	missense	probably damaging	0.97
R6390:Vmn2r117	UTSW	17	23460114	missense	possibly damaging	0.95
R6520:Vmn2r117	UTSW	17	23460219	missense	probably damaging	0.99
R6674:Vmn2r117	UTSW	17	23460049	nonsense	probably null
R6736:Vmn2r117	UTSW	17	23478308	missense	probably damaging	0.99
R6909:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
R6913:Vmn2r117	UTSW	17	23479563	missense	probably damaging	0.99
R7220:Vmn2r117	UTSW	17	23477203	missense	probably damaging	1.00
R7260:Vmn2r117	UTSW	17	23475385	missense	probably benign	0.06
R7440:Vmn2r117	UTSW	17	23475565	missense	probably benign	0.26
R7443:Vmn2r117	UTSW	17	23460133	missense	probably benign	0.25
R7443:Vmn2r117	UTSW	17	23460345	missense	probably damaging	1.00
R7449:Vmn2r117	UTSW	17	23459895	missense	probably damaging	1.00
R7644:Vmn2r117	UTSW	17	23477291	missense	probably damaging	0.98
R7914:Vmn2r117	UTSW	17	23460126	missense	possibly damaging	0.95
R8001:Vmn2r117	UTSW	17	23479407	missense	possibly damaging	0.89
R8029:Vmn2r117	UTSW	17	23477770	missense	probably benign	0.00
R8340:Vmn2r117	UTSW	17	23460537	missense	probably benign	0.01
R8519:Vmn2r117	UTSW	17	23479468	missense	probably benign
R8723:Vmn2r117	UTSW	17	23477369	missense	probably damaging	1.00
R8914:Vmn2r117	UTSW	17	23460169	missense	probably benign	0.02
R9010:Vmn2r117	UTSW	17	23460471	missense	probably benign	0.10
R9129:Vmn2r117	UTSW	17	23459944	nonsense	probably null
R9244:Vmn2r117	UTSW	17	23477615	missense	probably damaging	0.98
R9464:Vmn2r117	UTSW	17	23477604	missense	probably benign	0.23
R9620:Vmn2r117	UTSW	17	23478476	missense	probably damaging	0.97
V5622:Vmn2r117	UTSW	17	23477840	missense	probably damaging	1.00
V5622:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
Z1176:Vmn2r117	UTSW	17	23459766	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGGTCTACATGGACAGATTATGC -3'
(R):5'- GAATGGATGCACTTTAACTGTGAG -3'

Sequencing Primer
(F):5'- CACACTTGGTTTGGGCA -3'
(R):5'- GGTCTCAGCCTCTAAATGTAAGAC -3'

Posted On

2016-11-21