Incidental Mutation 'R0029:Prmt6'
ID44559
Institutional Source Beutler Lab
Gene Symbol Prmt6
Ensembl Gene ENSMUSG00000049300
Gene Nameprotein arginine N-methyltransferase 6
SynonymsHrmt1l6
MMRRC Submission 038323-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0029 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location110246109-110250998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110249898 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 358 (I358M)
Ref Sequence ENSEMBL: ENSMUSP00000140836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106567] [ENSMUST00000168412] [ENSMUST00000190378]
Predicted Effect probably benign
Transcript: ENSMUST00000106567
AA Change: I358M

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102177
Gene: ENSMUSG00000049300
AA Change: I358M

DomainStartEndE-ValueType
low complexity region 15 35 N/A INTRINSIC
Pfam:PRMT5 42 347 5.3e-9 PFAM
Pfam:Met_10 50 206 6.7e-8 PFAM
Pfam:Methyltransf_9 57 218 2.6e-8 PFAM
Pfam:PrmA 70 187 1.6e-10 PFAM
Pfam:MTS 75 189 8.8e-7 PFAM
Pfam:Methyltransf_18 85 191 1.8e-8 PFAM
Pfam:Methyltransf_11 90 188 6.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168412
AA Change: I358M

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129801
Gene: ENSMUSG00000049300
AA Change: I358M

DomainStartEndE-ValueType
low complexity region 15 35 N/A INTRINSIC
Pfam:PRMT5 42 347 1.3e-10 PFAM
Pfam:Met_10 51 184 1.2e-7 PFAM
Pfam:Methyltransf_9 57 218 2.6e-8 PFAM
Pfam:PrmA 70 187 1.4e-10 PFAM
Pfam:MTS 75 194 5.8e-8 PFAM
Pfam:Methyltransf_18 85 192 4.2e-13 PFAM
Pfam:Methyltransf_26 86 191 6e-10 PFAM
Pfam:Methyltransf_11 90 188 5.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190378
AA Change: I358M

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140836
Gene: ENSMUSG00000049300
AA Change: I358M

DomainStartEndE-ValueType
low complexity region 15 35 N/A INTRINSIC
Pfam:PRMT5 42 347 1.3e-10 PFAM
Pfam:Met_10 51 184 1.2e-7 PFAM
Pfam:Methyltransf_9 57 218 2.6e-8 PFAM
Pfam:PrmA 70 187 1.4e-10 PFAM
Pfam:MTS 75 194 5.8e-8 PFAM
Pfam:Methyltransf_18 85 192 4.2e-13 PFAM
Pfam:Methyltransf_26 86 191 6e-10 PFAM
Pfam:Methyltransf_11 90 188 5.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197569
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency 94% (48/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the arginine N-methyltransferase family, which catalyze the sequential transfer of methyl group from S-adenosyl-L-methionine to the side chain nitrogens of arginine residues within proteins, to form methylated arginine derivatives and S-adenosyl-L-homocysteine. This protein can catalyze both, the formation of omega-N monomethylarginine and asymmetrical dimethylarginine, with a strong preference for the latter. It specifically mediates the asymmetric dimethylation of Arg2 of histone H3, and the methylated form represents a specific tag for epigenetic transcriptional repression. This protein also forms a complex with, and methylates DNA polymerase beta, resulting in stimulation of polymerase activity by enhancing DNA binding and processivity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased mouse embryonic fibroblast proliferation and early cellular replicative senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik T C 15: 98,585,309 probably null Het
Abca15 T C 7: 120,346,002 F434L probably benign Het
Abt1 A T 13: 23,422,508 F141Y possibly damaging Het
Anapc15-ps A G 10: 95,672,995 I141T probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Axin2 A G 11: 108,924,047 T254A probably benign Het
Ciz1 A G 2: 32,371,419 probably benign Het
Cpa4 A G 6: 30,585,045 Y276C probably damaging Het
Cpt1a A G 19: 3,381,674 D698G probably benign Het
Crebbp T C 16: 4,117,443 T861A probably damaging Het
Dpy19l2 T A 9: 24,558,101 D753V probably damaging Het
Exosc7 A T 9: 123,119,237 probably benign Het
Fbxw28 T A 9: 109,328,289 D244V probably damaging Het
Fgd5 A G 6: 92,067,558 D1260G probably benign Het
Gapvd1 T A 2: 34,678,141 I1404F probably damaging Het
Gas7 A G 11: 67,643,337 S88G probably benign Het
Hk1 T C 10: 62,315,394 D57G probably damaging Het
Il23r A C 6: 67,478,945 probably null Het
Impg1 T C 9: 80,398,371 D138G probably damaging Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Kirrel2 A G 7: 30,453,165 probably benign Het
Lipm T C 19: 34,116,548 probably benign Het
Lrpap1 T C 5: 35,097,677 N205S possibly damaging Het
Mboat4 T G 8: 34,120,209 F87V probably damaging Het
Nadsyn1 G C 7: 143,806,078 Q386E probably benign Het
Nell1 G A 7: 50,120,715 probably benign Het
Olfr209 T C 16: 59,361,541 R226G probably benign Het
Olfr955 T A 9: 39,470,660 E22V probably benign Het
Pard3 G T 8: 127,426,758 probably benign Het
Per2 C A 1: 91,423,712 R1024L possibly damaging Het
Phf11c T C 14: 59,384,915 D216G probably benign Het
Polk G A 13: 96,516,670 T74I probably damaging Het
Psmb7 T A 2: 38,633,907 H152L probably damaging Het
Ralgps1 A T 2: 33,141,019 D498E probably benign Het
Slc26a2 G A 18: 61,202,310 P24S possibly damaging Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Stk38 T C 17: 28,982,138 E188G probably benign Het
Sulf2 T C 2: 166,116,973 N105S possibly damaging Het
Sult2a3 T A 7: 14,073,074 M228L probably benign Het
Svil C A 18: 5,063,286 D852E probably benign Het
Tcaf2 A T 6: 42,630,159 L287* probably null Het
Tmem132e A T 11: 82,444,761 I890F probably damaging Het
Tmem63a A G 1: 180,962,466 Y401C probably benign Het
Ttn T C 2: 76,766,506 E20021G probably damaging Het
Ubac1 G T 2: 26,021,443 T31N probably benign Het
Usp29 T C 7: 6,961,581 L141P probably damaging Het
Vmn1r179 A T 7: 23,929,205 I274F probably benign Het
Vmn1r204 A G 13: 22,556,418 Y73C probably benign Het
Vmn2r2 T C 3: 64,116,944 I739V probably benign Het
Wisp1 C T 15: 66,912,864 R129C probably damaging Het
Other mutations in Prmt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0928:Prmt6 UTSW 3 110250682 missense probably damaging 1.00
R1672:Prmt6 UTSW 3 110250571 missense possibly damaging 0.79
R1748:Prmt6 UTSW 3 110250367 missense probably benign
R3765:Prmt6 UTSW 3 110250194 nonsense probably null
R3835:Prmt6 UTSW 3 110250805 missense possibly damaging 0.75
R4027:Prmt6 UTSW 3 110249941 missense probably damaging 0.99
R6236:Prmt6 UTSW 3 110249898 missense probably benign 0.16
R7164:Prmt6 UTSW 3 110250364 missense probably benign
R7658:Prmt6 UTSW 3 110250385 missense possibly damaging 0.51
R7821:Prmt6 UTSW 3 110250987 start gained probably benign
Z1176:Prmt6 UTSW 3 110250130 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GCCCGTTAGTAAGCACACTGCATC -3'
(R):5'- GCCGTCTGGTTTCAAGTGACCTTTC -3'

Sequencing Primer
(F):5'- TGCCAGAAGAATGTCCTCAAATG -3'
(R):5'- TTTCCCGGAGGGGACTC -3'
Posted On2013-06-11