Incidental Mutation 'R5742:Ndufb5'
ID445599
Institutional Source Beutler Lab
Gene Symbol Ndufb5
Ensembl Gene ENSMUSG00000027673
Gene NameNADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5
Synonyms0610007D05Rik
MMRRC Submission 043352-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.808) question?
Stock #R5742 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location32736990-32751566 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32747781 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 112 (Y112H)
Ref Sequence ENSEMBL: ENSMUSP00000113169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029217] [ENSMUST00000121778] [ENSMUST00000122290] [ENSMUST00000127477] [ENSMUST00000139593] [ENSMUST00000154257]
Predicted Effect probably benign
Transcript: ENSMUST00000029217
Predicted Effect probably damaging
Transcript: ENSMUST00000121778
AA Change: Y112H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113169
Gene: ENSMUSG00000027673
AA Change: Y112H

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 163 5.1e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122290
AA Change: Y42H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113602
Gene: ENSMUSG00000027673
AA Change: Y42H

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 119 1.1e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127477
AA Change: Y112H

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114963
Gene: ENSMUSG00000027673
AA Change: Y112H

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 189 3.5e-91 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139593
AA Change: Y110H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115088
Gene: ENSMUSG00000027673
AA Change: Y110H

DomainStartEndE-ValueType
Pfam:NDUF_B5 6 172 6e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154257
AA Change: Y97H

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117240
Gene: ENSMUSG00000027673
AA Change: Y97H

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 135 8.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156174
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C T 11: 72,165,553 A794T possibly damaging Het
Abca9 T G 11: 110,160,417 E151A probably damaging Het
Abcb5 A G 12: 118,918,257 V579A probably damaging Het
Apob T A 12: 8,007,191 L1858Q probably damaging Het
Cerk C T 15: 86,141,572 E223K probably damaging Het
Cntnap2 T A 6: 45,920,926 Y179* probably null Het
Ddx60 A T 8: 61,948,921 Y277F probably benign Het
Dlgap1 T G 17: 70,718,199 V538G probably benign Het
Duox2 A G 2: 122,284,921 I1050T probably benign Het
Dusp10 A G 1: 184,037,656 probably null Het
Dusp27 A T 1: 166,099,454 V863E probably benign Het
Dync2h1 T A 9: 7,165,762 I500F possibly damaging Het
Erich3 T A 3: 154,733,323 C398S probably damaging Het
Fam213a T C 14: 41,002,503 E57G possibly damaging Het
Fez1 G A 9: 36,850,447 probably null Het
Fkbp3 A C 12: 65,070,038 H41Q probably benign Het
Fras1 C G 5: 96,768,381 Q3425E possibly damaging Het
Fuca1 T C 4: 135,922,975 V119A probably damaging Het
Grhl2 A G 15: 37,328,372 K414R probably damaging Het
Heatr5a A T 12: 51,955,552 C200* probably null Het
Hmgcs2 A G 3: 98,297,516 N330S probably benign Het
Hspd1 A G 1: 55,084,607 V118A probably benign Het
Jmjd1c A G 10: 67,220,333 T511A probably benign Het
Kat6b T C 14: 21,668,435 S1061P probably damaging Het
Kcnh6 T C 11: 106,009,142 V79A probably benign Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Klc4 C T 17: 46,642,271 R111Q probably damaging Het
Lrp1 T C 10: 127,548,347 D3641G probably damaging Het
Map2k1 A T 9: 64,193,771 D208E probably damaging Het
Masp1 T A 16: 23,454,925 M588L probably benign Het
Mgl2 T A 11: 70,136,684 N239K probably benign Het
Mki67 G A 7: 135,704,373 T625M probably benign Het
Npr3 A G 15: 11,883,408 S312P probably damaging Het
Nuf2 A T 1: 169,516,622 I125N probably damaging Het
Obox1 G A 7: 15,555,505 G73D possibly damaging Het
Olfr27 T A 9: 39,144,678 F193I probably benign Het
Olfr644 G T 7: 104,068,205 H275Q probably damaging Het
Pcdhb15 T C 18: 37,474,767 S351P probably damaging Het
Phc2 G T 4: 128,745,868 R121L probably damaging Het
Pla2g2a A G 4: 138,833,342 K87E probably benign Het
Plekhh2 T A 17: 84,597,980 S1101T probably damaging Het
Ppp4r1 T C 17: 65,837,746 I786T probably damaging Het
Ros1 A T 10: 52,142,138 probably null Het
Trnt1 T A 6: 106,778,917 L311* probably null Het
Ttc25 G A 11: 100,545,873 G25R possibly damaging Het
Vmn1r47 T A 6: 90,022,518 L211M probably damaging Het
Zfp12 A G 5: 143,245,190 E424G probably damaging Het
Zranb2 T A 3: 157,540,703 Y17* probably null Het
Other mutations in Ndufb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ndufb5 APN 3 32744899 missense probably damaging 0.98
IGL01688:Ndufb5 APN 3 32746464 nonsense probably null
IGL02629:Ndufb5 APN 3 32737199 missense probably benign 0.02
R0084:Ndufb5 UTSW 3 32737203 missense probably benign 0.02
R2851:Ndufb5 UTSW 3 32746451 missense probably damaging 1.00
R5663:Ndufb5 UTSW 3 32747749 missense possibly damaging 0.90
R6609:Ndufb5 UTSW 3 32741683 missense probably benign 0.01
Z31818:Ndufb5 UTSW 3 32746461 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CTCATGAGGGACTGATCTGC -3'
(R):5'- AGAGGAACCAAATTCTACTGACCAG -3'

Sequencing Primer
(F):5'- ATCTGCCCCGGGGAGTTTAG -3'
(R):5'- AGATGGCTCAGCAGTTTAGATCCC -3'
Posted On2016-11-21