Incidental Mutation 'R5742:Hmgcs2'
ID445600
Institutional Source Beutler Lab
Gene Symbol Hmgcs2
Ensembl Gene ENSMUSG00000027875
Gene Name3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2
SynonymsmHS
MMRRC Submission 043352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R5742 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location98280435-98310738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98297516 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 330 (N330S)
Ref Sequence ENSEMBL: ENSMUSP00000113296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090746] [ENSMUST00000120541]
Predicted Effect probably benign
Transcript: ENSMUST00000090746
AA Change: N330S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088249
Gene: ENSMUSG00000027875
AA Change: N330S

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 50 223 2.9e-111 PFAM
Pfam:HMG_CoA_synt_C 224 506 6.6e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120541
AA Change: N330S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113296
Gene: ENSMUSG00000027875
AA Change: N330S

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 50 223 7.2e-108 PFAM
Pfam:HMG_CoA_synt_C 224 506 1.8e-131 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the HMG-CoA synthase family. It is a mitochondrial enzyme that catalyzes the first reaction of ketogenesis, a metabolic pathway that provides lipid-derived energy for various organs during times of carbohydrate deprivation, such as fasting. Mutations in this gene are associated with HMG-CoA synthase deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C T 11: 72,165,553 A794T possibly damaging Het
Abca9 T G 11: 110,160,417 E151A probably damaging Het
Abcb5 A G 12: 118,918,257 V579A probably damaging Het
Apob T A 12: 8,007,191 L1858Q probably damaging Het
Cerk C T 15: 86,141,572 E223K probably damaging Het
Cntnap2 T A 6: 45,920,926 Y179* probably null Het
Ddx60 A T 8: 61,948,921 Y277F probably benign Het
Dlgap1 T G 17: 70,718,199 V538G probably benign Het
Duox2 A G 2: 122,284,921 I1050T probably benign Het
Dusp10 A G 1: 184,037,656 probably null Het
Dusp27 A T 1: 166,099,454 V863E probably benign Het
Dync2h1 T A 9: 7,165,762 I500F possibly damaging Het
Erich3 T A 3: 154,733,323 C398S probably damaging Het
Fam213a T C 14: 41,002,503 E57G possibly damaging Het
Fez1 G A 9: 36,850,447 probably null Het
Fkbp3 A C 12: 65,070,038 H41Q probably benign Het
Fras1 C G 5: 96,768,381 Q3425E possibly damaging Het
Fuca1 T C 4: 135,922,975 V119A probably damaging Het
Grhl2 A G 15: 37,328,372 K414R probably damaging Het
Heatr5a A T 12: 51,955,552 C200* probably null Het
Hspd1 A G 1: 55,084,607 V118A probably benign Het
Jmjd1c A G 10: 67,220,333 T511A probably benign Het
Kat6b T C 14: 21,668,435 S1061P probably damaging Het
Kcnh6 T C 11: 106,009,142 V79A probably benign Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Klc4 C T 17: 46,642,271 R111Q probably damaging Het
Lrp1 T C 10: 127,548,347 D3641G probably damaging Het
Map2k1 A T 9: 64,193,771 D208E probably damaging Het
Masp1 T A 16: 23,454,925 M588L probably benign Het
Mgl2 T A 11: 70,136,684 N239K probably benign Het
Mki67 G A 7: 135,704,373 T625M probably benign Het
Ndufb5 T C 3: 32,747,781 Y112H probably damaging Het
Npr3 A G 15: 11,883,408 S312P probably damaging Het
Nuf2 A T 1: 169,516,622 I125N probably damaging Het
Obox1 G A 7: 15,555,505 G73D possibly damaging Het
Olfr27 T A 9: 39,144,678 F193I probably benign Het
Olfr644 G T 7: 104,068,205 H275Q probably damaging Het
Pcdhb15 T C 18: 37,474,767 S351P probably damaging Het
Phc2 G T 4: 128,745,868 R121L probably damaging Het
Pla2g2a A G 4: 138,833,342 K87E probably benign Het
Plekhh2 T A 17: 84,597,980 S1101T probably damaging Het
Ppp4r1 T C 17: 65,837,746 I786T probably damaging Het
Ros1 A T 10: 52,142,138 probably null Het
Trnt1 T A 6: 106,778,917 L311* probably null Het
Ttc25 G A 11: 100,545,873 G25R possibly damaging Het
Vmn1r47 T A 6: 90,022,518 L211M probably damaging Het
Zfp12 A G 5: 143,245,190 E424G probably damaging Het
Zranb2 T A 3: 157,540,703 Y17* probably null Het
Other mutations in Hmgcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0579:Hmgcs2 UTSW 3 98290948 missense probably damaging 1.00
R0657:Hmgcs2 UTSW 3 98291053 missense probably benign
R0724:Hmgcs2 UTSW 3 98297001 nonsense probably null
R2024:Hmgcs2 UTSW 3 98299214 missense probably damaging 1.00
R2109:Hmgcs2 UTSW 3 98297021 nonsense probably null
R2202:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2203:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2204:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2205:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R3758:Hmgcs2 UTSW 3 98291090 missense probably damaging 1.00
R3779:Hmgcs2 UTSW 3 98299112 splice site probably benign
R3958:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3959:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3960:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3962:Hmgcs2 UTSW 3 98291038 missense possibly damaging 0.91
R4788:Hmgcs2 UTSW 3 98291084 missense probably damaging 1.00
R5102:Hmgcs2 UTSW 3 98280470 start gained probably benign
R5708:Hmgcs2 UTSW 3 98291162 missense probably damaging 1.00
R7268:Hmgcs2 UTSW 3 98297480 missense probably benign 0.02
R7294:Hmgcs2 UTSW 3 98290895 missense probably benign 0.09
R7503:Hmgcs2 UTSW 3 98302624 missense probably damaging 1.00
R7767:Hmgcs2 UTSW 3 98291266 missense probably damaging 1.00
R8043:Hmgcs2 UTSW 3 98291128 missense probably damaging 1.00
Z1176:Hmgcs2 UTSW 3 98290945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAACCATCTCTCTGGGAAG -3'
(R):5'- AAGAATGGCTTAGCATCCCTTCTG -3'

Sequencing Primer
(F):5'- GGCATCGTTACATTTGGCAAAG -3'
(R):5'- CATCCCTTCTGCTGTGTTGGAG -3'
Posted On2016-11-21