Incidental Mutation 'R5742:Kel'
ID445607
Institutional Source Beutler Lab
Gene Symbol Kel
Ensembl Gene ENSMUSG00000029866
Gene NameKell blood group
SynonymsCD238
MMRRC Submission 043352-MU
Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5742 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location41686330-41704339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41699027 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 243 (G243E)
Ref Sequence ENSEMBL: ENSMUSP00000031899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031899]
Predicted Effect probably damaging
Transcript: ENSMUST00000031899
AA Change: G243E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: G243E

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Peptidase_M13_N 81 463 1.5e-68 PFAM
Pfam:Peptidase_M13 521 712 2.1e-58 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000192118
AA Change: G18E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192406
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C T 11: 72,165,553 A794T possibly damaging Het
Abca9 T G 11: 110,160,417 E151A probably damaging Het
Abcb5 A G 12: 118,918,257 V579A probably damaging Het
Apob T A 12: 8,007,191 L1858Q probably damaging Het
Cerk C T 15: 86,141,572 E223K probably damaging Het
Cntnap2 T A 6: 45,920,926 Y179* probably null Het
Ddx60 A T 8: 61,948,921 Y277F probably benign Het
Dlgap1 T G 17: 70,718,199 V538G probably benign Het
Duox2 A G 2: 122,284,921 I1050T probably benign Het
Dusp10 A G 1: 184,037,656 probably null Het
Dusp27 A T 1: 166,099,454 V863E probably benign Het
Dync2h1 T A 9: 7,165,762 I500F possibly damaging Het
Erich3 T A 3: 154,733,323 C398S probably damaging Het
Fam213a T C 14: 41,002,503 E57G possibly damaging Het
Fez1 G A 9: 36,850,447 probably null Het
Fkbp3 A C 12: 65,070,038 H41Q probably benign Het
Fras1 C G 5: 96,768,381 Q3425E possibly damaging Het
Fuca1 T C 4: 135,922,975 V119A probably damaging Het
Grhl2 A G 15: 37,328,372 K414R probably damaging Het
Heatr5a A T 12: 51,955,552 C200* probably null Het
Hmgcs2 A G 3: 98,297,516 N330S probably benign Het
Hspd1 A G 1: 55,084,607 V118A probably benign Het
Jmjd1c A G 10: 67,220,333 T511A probably benign Het
Kat6b T C 14: 21,668,435 S1061P probably damaging Het
Kcnh6 T C 11: 106,009,142 V79A probably benign Het
Klc4 C T 17: 46,642,271 R111Q probably damaging Het
Lrp1 T C 10: 127,548,347 D3641G probably damaging Het
Map2k1 A T 9: 64,193,771 D208E probably damaging Het
Masp1 T A 16: 23,454,925 M588L probably benign Het
Mgl2 T A 11: 70,136,684 N239K probably benign Het
Mki67 G A 7: 135,704,373 T625M probably benign Het
Ndufb5 T C 3: 32,747,781 Y112H probably damaging Het
Npr3 A G 15: 11,883,408 S312P probably damaging Het
Nuf2 A T 1: 169,516,622 I125N probably damaging Het
Obox1 G A 7: 15,555,505 G73D possibly damaging Het
Olfr27 T A 9: 39,144,678 F193I probably benign Het
Olfr644 G T 7: 104,068,205 H275Q probably damaging Het
Pcdhb15 T C 18: 37,474,767 S351P probably damaging Het
Phc2 G T 4: 128,745,868 R121L probably damaging Het
Pla2g2a A G 4: 138,833,342 K87E probably benign Het
Plekhh2 T A 17: 84,597,980 S1101T probably damaging Het
Ppp4r1 T C 17: 65,837,746 I786T probably damaging Het
Ros1 A T 10: 52,142,138 probably null Het
Trnt1 T A 6: 106,778,917 L311* probably null Het
Ttc25 G A 11: 100,545,873 G25R possibly damaging Het
Vmn1r47 T A 6: 90,022,518 L211M probably damaging Het
Zfp12 A G 5: 143,245,190 E424G probably damaging Het
Zranb2 T A 3: 157,540,703 Y17* probably null Het
Other mutations in Kel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Kel APN 6 41688575 missense probably damaging 1.00
IGL00792:Kel APN 6 41702012 missense probably damaging 1.00
IGL00972:Kel APN 6 41688066 missense possibly damaging 0.62
IGL01121:Kel APN 6 41702409 missense probably benign 0.00
IGL01286:Kel APN 6 41688117 splice site probably null
IGL01461:Kel APN 6 41701911 critical splice donor site probably null
IGL01836:Kel APN 6 41697438 missense possibly damaging 0.50
IGL02037:Kel APN 6 41697474 missense probably benign 0.01
IGL02103:Kel APN 6 41702389 missense probably benign 0.18
IGL02604:Kel APN 6 41687582 missense probably damaging 0.98
IGL03102:Kel APN 6 41702983 missense probably benign 0.00
IGL03274:Kel APN 6 41687995 splice site probably null
IGL03355:Kel APN 6 41698887 critical splice donor site probably null
A4554:Kel UTSW 6 41697419 missense possibly damaging 0.95
R0121:Kel UTSW 6 41702064 unclassified probably benign
R0153:Kel UTSW 6 41701943 missense probably benign 0.08
R0535:Kel UTSW 6 41690838 missense probably null 0.21
R0658:Kel UTSW 6 41703031 missense probably damaging 1.00
R1005:Kel UTSW 6 41688617 missense probably damaging 1.00
R1199:Kel UTSW 6 41688591 missense possibly damaging 0.95
R1272:Kel UTSW 6 41703470 missense probably benign 0.00
R1531:Kel UTSW 6 41688626 missense probably damaging 0.99
R1880:Kel UTSW 6 41687545 missense possibly damaging 0.95
R2102:Kel UTSW 6 41686484 missense possibly damaging 0.86
R2118:Kel UTSW 6 41689300 missense probably benign
R2571:Kel UTSW 6 41688067 missense possibly damaging 0.62
R4209:Kel UTSW 6 41698425 nonsense probably null
R4210:Kel UTSW 6 41698425 nonsense probably null
R4260:Kel UTSW 6 41686423 utr 3 prime probably benign
R4382:Kel UTSW 6 41698400 missense probably benign 0.13
R5023:Kel UTSW 6 41688111 missense probably damaging 1.00
R5033:Kel UTSW 6 41699055 missense probably damaging 1.00
R5239:Kel UTSW 6 41688114 nonsense probably null
R5431:Kel UTSW 6 41698420 missense probably benign 0.23
R5745:Kel UTSW 6 41699027 missense probably damaging 1.00
R5746:Kel UTSW 6 41699027 missense probably damaging 1.00
R5978:Kel UTSW 6 41688045 missense probably benign 0.00
R6023:Kel UTSW 6 41697475 missense probably benign
R6109:Kel UTSW 6 41688862 missense probably benign 0.06
R6125:Kel UTSW 6 41690786 missense probably damaging 1.00
R6319:Kel UTSW 6 41702447 missense probably benign 0.05
R6368:Kel UTSW 6 41688851 nonsense probably null
R6864:Kel UTSW 6 41703760 critical splice donor site probably null
R6956:Kel UTSW 6 41687973 missense probably damaging 1.00
R7644:Kel UTSW 6 41690808 missense probably benign 0.03
R7938:Kel UTSW 6 41698376 missense probably benign 0.06
R8028:Kel UTSW 6 41699024 missense probably benign 0.21
R8082:Kel UTSW 6 41703490 missense possibly damaging 0.94
R8465:Kel UTSW 6 41689538 critical splice donor site probably null
X0028:Kel UTSW 6 41698351 missense probably damaging 0.99
Z1176:Kel UTSW 6 41687572 missense probably damaging 1.00
Z1177:Kel UTSW 6 41689559 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGAGACCATCAAGCACAG -3'
(R):5'- TCTCTTGTGTCCAGATAGACCAG -3'

Sequencing Primer
(F):5'- GAGTCCCCAGACCCTCAG -3'
(R):5'- TAGACCAGCCGGAGTTTGACATTC -3'
Posted On2016-11-21