Incidental Mutation 'R5742:Odad4'
ID 445624
Institutional Source Beutler Lab
Gene Symbol Odad4
Ensembl Gene ENSMUSG00000006784
Gene Name outer dynein arm complex subunit 4
Synonyms 4933404O19Rik, Ttc25
MMRRC Submission 043352-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R5742 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 100436434-100463392 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 100436699 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 25 (G25R)
Ref Sequence ENSEMBL: ENSMUSP00000090355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006976] [ENSMUST00000092684]
AlphaFold Q9D4B2
Predicted Effect possibly damaging
Transcript: ENSMUST00000006976
AA Change: G25R

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006976
Gene: ENSMUSG00000006784
AA Change: G25R

DomainStartEndE-ValueType
TPR 11 44 3.69e1 SMART
TPR 45 78 3.07e1 SMART
TPR 79 112 4.96e0 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
TPR 318 351 4.96e0 SMART
TPR 358 391 1.11e1 SMART
Blast:TPR 395 428 7e-14 BLAST
TPR 435 468 2.99e1 SMART
low complexity region 493 505 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000092684
AA Change: G25R

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090355
Gene: ENSMUSG00000006784
AA Change: G25R

DomainStartEndE-ValueType
TPR 11 44 3.69e1 SMART
TPR 45 78 3.07e1 SMART
TPR 79 112 4.96e0 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
TPR 318 351 4.96e0 SMART
TPR 358 391 1.11e1 SMART
Blast:TPR 395 428 5e-14 BLAST
TPR 435 468 2.99e1 SMART
coiled coil region 528 548 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
coiled coil region 599 624 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150331
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display partial preweaning lethality, impaired ciliary motility, and a variety of left-right body symmetry defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C T 11: 72,056,379 (GRCm39) A794T possibly damaging Het
Abca9 T G 11: 110,051,243 (GRCm39) E151A probably damaging Het
Abcb5 A G 12: 118,881,992 (GRCm39) V579A probably damaging Het
Apob T A 12: 8,057,191 (GRCm39) L1858Q probably damaging Het
Cerk C T 15: 86,025,773 (GRCm39) E223K probably damaging Het
Cntnap2 T A 6: 45,897,860 (GRCm39) Y179* probably null Het
Ddx60 A T 8: 62,401,955 (GRCm39) Y277F probably benign Het
Dlgap1 T G 17: 71,025,194 (GRCm39) V538G probably benign Het
Duox2 A G 2: 122,115,402 (GRCm39) I1050T probably benign Het
Dusp10 A G 1: 183,769,853 (GRCm39) probably null Het
Dync2h1 T A 9: 7,165,762 (GRCm39) I500F possibly damaging Het
Erich3 T A 3: 154,438,960 (GRCm39) C398S probably damaging Het
Fez1 G A 9: 36,761,743 (GRCm39) probably null Het
Fkbp3 A C 12: 65,116,812 (GRCm39) H41Q probably benign Het
Fras1 C G 5: 96,916,240 (GRCm39) Q3425E possibly damaging Het
Fuca1 T C 4: 135,650,286 (GRCm39) V119A probably damaging Het
Grhl2 A G 15: 37,328,616 (GRCm39) K414R probably damaging Het
Heatr5a A T 12: 52,002,335 (GRCm39) C200* probably null Het
Hmgcs2 A G 3: 98,204,832 (GRCm39) N330S probably benign Het
Hspd1 A G 1: 55,123,766 (GRCm39) V118A probably benign Het
Jmjd1c A G 10: 67,056,112 (GRCm39) T511A probably benign Het
Kat6b T C 14: 21,718,503 (GRCm39) S1061P probably damaging Het
Kcnh6 T C 11: 105,899,968 (GRCm39) V79A probably benign Het
Kel C T 6: 41,675,961 (GRCm39) G243E probably damaging Het
Klc4 C T 17: 46,953,197 (GRCm39) R111Q probably damaging Het
Lrp1 T C 10: 127,384,216 (GRCm39) D3641G probably damaging Het
Map2k1 A T 9: 64,101,053 (GRCm39) D208E probably damaging Het
Masp1 T A 16: 23,273,675 (GRCm39) M588L probably benign Het
Mgl2 T A 11: 70,027,510 (GRCm39) N239K probably benign Het
Mki67 G A 7: 135,306,102 (GRCm39) T625M probably benign Het
Ndufb5 T C 3: 32,801,930 (GRCm39) Y112H probably damaging Het
Npr3 A G 15: 11,883,494 (GRCm39) S312P probably damaging Het
Nuf2 A T 1: 169,344,191 (GRCm39) I125N probably damaging Het
Obox1 G A 7: 15,289,430 (GRCm39) G73D possibly damaging Het
Or51a43 G T 7: 103,717,412 (GRCm39) H275Q probably damaging Het
Or8g19 T A 9: 39,055,974 (GRCm39) F193I probably benign Het
Pcdhb15 T C 18: 37,607,820 (GRCm39) S351P probably damaging Het
Phc2 G T 4: 128,639,661 (GRCm39) R121L probably damaging Het
Pla2g2a A G 4: 138,560,653 (GRCm39) K87E probably benign Het
Plekhh2 T A 17: 84,905,408 (GRCm39) S1101T probably damaging Het
Ppp4r1 T C 17: 66,144,741 (GRCm39) I786T probably damaging Het
Prxl2a T C 14: 40,724,460 (GRCm39) E57G possibly damaging Het
Ros1 A T 10: 52,018,234 (GRCm39) probably null Het
Styxl2 A T 1: 165,927,023 (GRCm39) V863E probably benign Het
Trnt1 T A 6: 106,755,878 (GRCm39) L311* probably null Het
Vmn1r47 T A 6: 89,999,500 (GRCm39) L211M probably damaging Het
Zfp12 A G 5: 143,230,945 (GRCm39) E424G probably damaging Het
Zranb2 T A 3: 157,246,340 (GRCm39) Y17* probably null Het
Other mutations in Odad4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Odad4 APN 11 100,460,728 (GRCm39) missense probably damaging 1.00
IGL02379:Odad4 APN 11 100,457,809 (GRCm39) missense possibly damaging 0.87
IGL03091:Odad4 APN 11 100,441,076 (GRCm39) nonsense probably null
IGL02991:Odad4 UTSW 11 100,444,698 (GRCm39) missense probably benign 0.01
R0044:Odad4 UTSW 11 100,457,827 (GRCm39) missense probably damaging 1.00
R0137:Odad4 UTSW 11 100,454,394 (GRCm39) missense probably damaging 1.00
R0280:Odad4 UTSW 11 100,441,091 (GRCm39) missense probably damaging 1.00
R1373:Odad4 UTSW 11 100,436,658 (GRCm39) missense probably damaging 1.00
R1793:Odad4 UTSW 11 100,460,679 (GRCm39) splice site probably null
R2097:Odad4 UTSW 11 100,454,408 (GRCm39) missense possibly damaging 0.89
R2121:Odad4 UTSW 11 100,457,837 (GRCm39) critical splice donor site probably null
R2509:Odad4 UTSW 11 100,444,361 (GRCm39) missense probably damaging 0.99
R2655:Odad4 UTSW 11 100,444,405 (GRCm39) missense probably damaging 1.00
R4635:Odad4 UTSW 11 100,442,333 (GRCm39) nonsense probably null
R4773:Odad4 UTSW 11 100,440,742 (GRCm39) missense probably benign 0.05
R4858:Odad4 UTSW 11 100,441,147 (GRCm39) missense probably damaging 0.96
R5164:Odad4 UTSW 11 100,462,346 (GRCm39) nonsense probably null
R5181:Odad4 UTSW 11 100,440,719 (GRCm39) missense probably damaging 1.00
R5707:Odad4 UTSW 11 100,444,887 (GRCm39) missense probably damaging 0.99
R7634:Odad4 UTSW 11 100,452,731 (GRCm39) critical splice donor site probably null
R7851:Odad4 UTSW 11 100,436,655 (GRCm39) missense probably damaging 1.00
R8186:Odad4 UTSW 11 100,454,505 (GRCm39) missense probably benign 0.27
R8194:Odad4 UTSW 11 100,454,502 (GRCm39) missense probably benign 0.06
R8444:Odad4 UTSW 11 100,452,731 (GRCm39) critical splice donor site probably null
R8879:Odad4 UTSW 11 100,457,752 (GRCm39) nonsense probably null
X0018:Odad4 UTSW 11 100,444,424 (GRCm39) missense probably damaging 0.99
X0028:Odad4 UTSW 11 100,436,724 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCTAGGTTGCTAAGAGACCGG -3'
(R):5'- GTCATCTCTCAGGAAGTAGGGG -3'

Sequencing Primer
(F):5'- TTGCTAAGAGACCGGGCTGTC -3'
(R):5'- GGTCTACAGAACAAGTGTCTATCTC -3'
Posted On 2016-11-21