Incidental Mutation 'R5742:Fkbp3'
ID445628
Institutional Source Beutler Lab
Gene Symbol Fkbp3
Ensembl Gene ENSMUSG00000020949
Gene NameFK506 binding protein 3
Synonyms25kDa, FKBP25
MMRRC Submission 043352-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5742 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location65062424-65074007 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65070038 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 41 (H41Q)
Ref Sequence ENSEMBL: ENSMUSP00000152766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021332] [ENSMUST00000220730] [ENSMUST00000221166] [ENSMUST00000221913]
Predicted Effect probably benign
Transcript: ENSMUST00000021332
AA Change: H41Q

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000021332
Gene: ENSMUSG00000020949
AA Change: H41Q

DomainStartEndE-ValueType
PDB:2KFV|A 1 73 2e-45 PDB
low complexity region 91 100 N/A INTRINSIC
Pfam:FKBP_C 121 221 3.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220730
AA Change: H41Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220957
Predicted Effect unknown
Transcript: ENSMUST00000220983
AA Change: H33Q
Predicted Effect probably benign
Transcript: ENSMUST00000221166
AA Change: H41Q

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000221608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221710
Predicted Effect unknown
Transcript: ENSMUST00000221913
AA Change: I41R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223519
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin, as well as histone deacetylases, the transcription factor YY1, casein kinase II, and nucleolin. It has a higher affinity for rapamycin than for FK506 and thus may be an important target molecule for immunosuppression by rapamycin. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C T 11: 72,165,553 A794T possibly damaging Het
Abca9 T G 11: 110,160,417 E151A probably damaging Het
Abcb5 A G 12: 118,918,257 V579A probably damaging Het
Apob T A 12: 8,007,191 L1858Q probably damaging Het
Cerk C T 15: 86,141,572 E223K probably damaging Het
Cntnap2 T A 6: 45,920,926 Y179* probably null Het
Ddx60 A T 8: 61,948,921 Y277F probably benign Het
Dlgap1 T G 17: 70,718,199 V538G probably benign Het
Duox2 A G 2: 122,284,921 I1050T probably benign Het
Dusp10 A G 1: 184,037,656 probably null Het
Dusp27 A T 1: 166,099,454 V863E probably benign Het
Dync2h1 T A 9: 7,165,762 I500F possibly damaging Het
Erich3 T A 3: 154,733,323 C398S probably damaging Het
Fam213a T C 14: 41,002,503 E57G possibly damaging Het
Fez1 G A 9: 36,850,447 probably null Het
Fras1 C G 5: 96,768,381 Q3425E possibly damaging Het
Fuca1 T C 4: 135,922,975 V119A probably damaging Het
Grhl2 A G 15: 37,328,372 K414R probably damaging Het
Heatr5a A T 12: 51,955,552 C200* probably null Het
Hmgcs2 A G 3: 98,297,516 N330S probably benign Het
Hspd1 A G 1: 55,084,607 V118A probably benign Het
Jmjd1c A G 10: 67,220,333 T511A probably benign Het
Kat6b T C 14: 21,668,435 S1061P probably damaging Het
Kcnh6 T C 11: 106,009,142 V79A probably benign Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Klc4 C T 17: 46,642,271 R111Q probably damaging Het
Lrp1 T C 10: 127,548,347 D3641G probably damaging Het
Map2k1 A T 9: 64,193,771 D208E probably damaging Het
Masp1 T A 16: 23,454,925 M588L probably benign Het
Mgl2 T A 11: 70,136,684 N239K probably benign Het
Mki67 G A 7: 135,704,373 T625M probably benign Het
Ndufb5 T C 3: 32,747,781 Y112H probably damaging Het
Npr3 A G 15: 11,883,408 S312P probably damaging Het
Nuf2 A T 1: 169,516,622 I125N probably damaging Het
Obox1 G A 7: 15,555,505 G73D possibly damaging Het
Olfr27 T A 9: 39,144,678 F193I probably benign Het
Olfr644 G T 7: 104,068,205 H275Q probably damaging Het
Pcdhb15 T C 18: 37,474,767 S351P probably damaging Het
Phc2 G T 4: 128,745,868 R121L probably damaging Het
Pla2g2a A G 4: 138,833,342 K87E probably benign Het
Plekhh2 T A 17: 84,597,980 S1101T probably damaging Het
Ppp4r1 T C 17: 65,837,746 I786T probably damaging Het
Ros1 A T 10: 52,142,138 probably null Het
Trnt1 T A 6: 106,778,917 L311* probably null Het
Ttc25 G A 11: 100,545,873 G25R possibly damaging Het
Vmn1r47 T A 6: 90,022,518 L211M probably damaging Het
Zfp12 A G 5: 143,245,190 E424G probably damaging Het
Zranb2 T A 3: 157,540,703 Y17* probably null Het
Other mutations in Fkbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02670:Fkbp3 APN 12 65069103 nonsense probably null
R0632:Fkbp3 UTSW 12 65073918 missense probably benign 0.03
R4407:Fkbp3 UTSW 12 65070004 missense probably damaging 0.99
R6027:Fkbp3 UTSW 12 65073918 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCCTTGCTTGATATAACAAAGCCC -3'
(R):5'- GCAGCTAGCACAGAAAGATTGTTTC -3'

Sequencing Primer
(F):5'- TCACAGCTAAGAAAAACTATAGGTGG -3'
(R):5'- AGACAGGGTCTCATGTATCTCAGC -3'
Posted On2016-11-21