Incidental Mutation 'R5742:Masp1'
ID 445636
Institutional Source Beutler Lab
Gene Symbol Masp1
Ensembl Gene ENSMUSG00000022887
Gene Name MBL associated serine protease 1
Synonyms Crarf
MMRRC Submission 043352-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R5742 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 23268167-23339565 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23273675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 588 (M588L)
Ref Sequence ENSEMBL: ENSMUSP00000087327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089883]
AlphaFold P98064
Predicted Effect probably benign
Transcript: ENSMUST00000089883
AA Change: M588L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000087327
Gene: ENSMUSG00000022887
AA Change: M588L

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
CUB 23 143 2.96e-36 SMART
EGF_CA 144 187 1.46e-7 SMART
CUB 190 302 1.49e-41 SMART
CCP 306 367 4.41e-12 SMART
CCP 372 437 3.05e-6 SMART
Tryp_SPc 453 696 4.66e-84 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele display decreased survivor rate, reduced body weight, and impaired activation of the lectin and alternative complement pathways. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C T 11: 72,056,379 (GRCm39) A794T possibly damaging Het
Abca9 T G 11: 110,051,243 (GRCm39) E151A probably damaging Het
Abcb5 A G 12: 118,881,992 (GRCm39) V579A probably damaging Het
Apob T A 12: 8,057,191 (GRCm39) L1858Q probably damaging Het
Cerk C T 15: 86,025,773 (GRCm39) E223K probably damaging Het
Cntnap2 T A 6: 45,897,860 (GRCm39) Y179* probably null Het
Ddx60 A T 8: 62,401,955 (GRCm39) Y277F probably benign Het
Dlgap1 T G 17: 71,025,194 (GRCm39) V538G probably benign Het
Duox2 A G 2: 122,115,402 (GRCm39) I1050T probably benign Het
Dusp10 A G 1: 183,769,853 (GRCm39) probably null Het
Dync2h1 T A 9: 7,165,762 (GRCm39) I500F possibly damaging Het
Erich3 T A 3: 154,438,960 (GRCm39) C398S probably damaging Het
Fez1 G A 9: 36,761,743 (GRCm39) probably null Het
Fkbp3 A C 12: 65,116,812 (GRCm39) H41Q probably benign Het
Fras1 C G 5: 96,916,240 (GRCm39) Q3425E possibly damaging Het
Fuca1 T C 4: 135,650,286 (GRCm39) V119A probably damaging Het
Grhl2 A G 15: 37,328,616 (GRCm39) K414R probably damaging Het
Heatr5a A T 12: 52,002,335 (GRCm39) C200* probably null Het
Hmgcs2 A G 3: 98,204,832 (GRCm39) N330S probably benign Het
Hspd1 A G 1: 55,123,766 (GRCm39) V118A probably benign Het
Jmjd1c A G 10: 67,056,112 (GRCm39) T511A probably benign Het
Kat6b T C 14: 21,718,503 (GRCm39) S1061P probably damaging Het
Kcnh6 T C 11: 105,899,968 (GRCm39) V79A probably benign Het
Kel C T 6: 41,675,961 (GRCm39) G243E probably damaging Het
Klc4 C T 17: 46,953,197 (GRCm39) R111Q probably damaging Het
Lrp1 T C 10: 127,384,216 (GRCm39) D3641G probably damaging Het
Map2k1 A T 9: 64,101,053 (GRCm39) D208E probably damaging Het
Mgl2 T A 11: 70,027,510 (GRCm39) N239K probably benign Het
Mki67 G A 7: 135,306,102 (GRCm39) T625M probably benign Het
Ndufb5 T C 3: 32,801,930 (GRCm39) Y112H probably damaging Het
Npr3 A G 15: 11,883,494 (GRCm39) S312P probably damaging Het
Nuf2 A T 1: 169,344,191 (GRCm39) I125N probably damaging Het
Obox1 G A 7: 15,289,430 (GRCm39) G73D possibly damaging Het
Odad4 G A 11: 100,436,699 (GRCm39) G25R possibly damaging Het
Or51a43 G T 7: 103,717,412 (GRCm39) H275Q probably damaging Het
Or8g19 T A 9: 39,055,974 (GRCm39) F193I probably benign Het
Pcdhb15 T C 18: 37,607,820 (GRCm39) S351P probably damaging Het
Phc2 G T 4: 128,639,661 (GRCm39) R121L probably damaging Het
Pla2g2a A G 4: 138,560,653 (GRCm39) K87E probably benign Het
Plekhh2 T A 17: 84,905,408 (GRCm39) S1101T probably damaging Het
Ppp4r1 T C 17: 66,144,741 (GRCm39) I786T probably damaging Het
Prxl2a T C 14: 40,724,460 (GRCm39) E57G possibly damaging Het
Ros1 A T 10: 52,018,234 (GRCm39) probably null Het
Styxl2 A T 1: 165,927,023 (GRCm39) V863E probably benign Het
Trnt1 T A 6: 106,755,878 (GRCm39) L311* probably null Het
Vmn1r47 T A 6: 89,999,500 (GRCm39) L211M probably damaging Het
Zfp12 A G 5: 143,230,945 (GRCm39) E424G probably damaging Het
Zranb2 T A 3: 157,246,340 (GRCm39) Y17* probably null Het
Other mutations in Masp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Masp1 APN 16 23,276,841 (GRCm39) missense possibly damaging 0.93
IGL00428:Masp1 APN 16 23,295,062 (GRCm39) missense probably damaging 1.00
IGL00432:Masp1 APN 16 23,332,601 (GRCm39) missense probably damaging 1.00
IGL02598:Masp1 APN 16 23,278,381 (GRCm39) missense probably benign
IGL02718:Masp1 APN 16 23,295,043 (GRCm39) missense probably damaging 1.00
IGL02947:Masp1 APN 16 23,313,476 (GRCm39) missense probably damaging 0.99
A4554:Masp1 UTSW 16 23,273,690 (GRCm39) splice site probably null
PIT1430001:Masp1 UTSW 16 23,332,694 (GRCm39) missense probably damaging 1.00
R0103:Masp1 UTSW 16 23,276,768 (GRCm39) missense probably damaging 1.00
R0505:Masp1 UTSW 16 23,276,888 (GRCm39) missense probably benign
R0630:Masp1 UTSW 16 23,271,169 (GRCm39) missense probably benign 0.01
R1146:Masp1 UTSW 16 23,310,865 (GRCm39) missense probably damaging 1.00
R1146:Masp1 UTSW 16 23,310,865 (GRCm39) missense probably damaging 1.00
R1339:Masp1 UTSW 16 23,271,217 (GRCm39) missense probably damaging 1.00
R1521:Masp1 UTSW 16 23,313,387 (GRCm39) missense probably damaging 1.00
R1588:Masp1 UTSW 16 23,313,404 (GRCm39) missense probably damaging 1.00
R1961:Masp1 UTSW 16 23,271,682 (GRCm39) missense probably damaging 1.00
R1986:Masp1 UTSW 16 23,302,211 (GRCm39) missense probably benign 0.01
R2080:Masp1 UTSW 16 23,310,709 (GRCm39) missense probably damaging 1.00
R2215:Masp1 UTSW 16 23,271,271 (GRCm39) missense possibly damaging 0.92
R2216:Masp1 UTSW 16 23,310,805 (GRCm39) missense probably benign 0.00
R2443:Masp1 UTSW 16 23,295,062 (GRCm39) missense probably damaging 1.00
R4934:Masp1 UTSW 16 23,283,826 (GRCm39) missense probably damaging 0.98
R5224:Masp1 UTSW 16 23,313,445 (GRCm39) missense probably damaging 1.00
R5340:Masp1 UTSW 16 23,276,858 (GRCm39) missense probably damaging 1.00
R5562:Masp1 UTSW 16 23,283,917 (GRCm39) splice site probably null
R5663:Masp1 UTSW 16 23,271,688 (GRCm39) missense possibly damaging 0.57
R5763:Masp1 UTSW 16 23,314,997 (GRCm39) missense probably damaging 1.00
R5898:Masp1 UTSW 16 23,310,677 (GRCm39) missense probably damaging 0.99
R6901:Masp1 UTSW 16 23,332,584 (GRCm39) missense probably damaging 0.99
R6987:Masp1 UTSW 16 23,332,665 (GRCm39) missense probably damaging 1.00
R7069:Masp1 UTSW 16 23,271,205 (GRCm39) missense probably benign 0.20
R7356:Masp1 UTSW 16 23,288,993 (GRCm39) missense possibly damaging 0.50
R7512:Masp1 UTSW 16 23,288,874 (GRCm39) missense probably damaging 1.00
R7539:Masp1 UTSW 16 23,289,128 (GRCm39) missense possibly damaging 0.94
R7810:Masp1 UTSW 16 23,295,068 (GRCm39) missense probably benign 0.01
R8026:Masp1 UTSW 16 23,303,156 (GRCm39) missense probably damaging 1.00
R8391:Masp1 UTSW 16 23,289,128 (GRCm39) missense possibly damaging 0.94
R8438:Masp1 UTSW 16 23,289,153 (GRCm39) missense probably benign 0.38
R8475:Masp1 UTSW 16 23,271,281 (GRCm39) missense probably damaging 0.99
R8870:Masp1 UTSW 16 23,314,882 (GRCm39) missense probably damaging 1.00
R9052:Masp1 UTSW 16 23,339,350 (GRCm39) start gained probably benign
R9072:Masp1 UTSW 16 23,288,671 (GRCm39) missense probably benign 0.07
R9073:Masp1 UTSW 16 23,288,671 (GRCm39) missense probably benign 0.07
R9599:Masp1 UTSW 16 23,271,698 (GRCm39) missense probably benign 0.16
R9686:Masp1 UTSW 16 23,314,887 (GRCm39) missense probably damaging 1.00
X0065:Masp1 UTSW 16 23,332,719 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAAGTTGAGTTTGGCCCC -3'
(R):5'- TTGAGGTAGATCAACCAAGAAACC -3'

Sequencing Primer
(F):5'- GTTGAGTTTGGCCCCCATCTTTTATC -3'
(R):5'- CAGGTAACCCATCACAGAAGCAATG -3'
Posted On 2016-11-21