Incidental Mutation 'R5743:Ssrp1'
ID445647
Institutional Source Beutler Lab
Gene Symbol Ssrp1
Ensembl Gene ENSMUSG00000027067
Gene Namestructure specific recognition protein 1
SynonymsHmgi-rs3, T160, Hmgox, Hmg1-rs1
MMRRC Submission 043353-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5743 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85037234-85047109 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 85041168 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 311 (Y311*)
Ref Sequence ENSEMBL: ENSMUSP00000127058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077798] [ENSMUST00000111613] [ENSMUST00000130729] [ENSMUST00000168266]
Predicted Effect probably null
Transcript: ENSMUST00000077798
AA Change: Y311*
SMART Domains Protein: ENSMUSP00000076971
Gene: ENSMUSG00000027067
AA Change: Y311*

DomainStartEndE-ValueType
Pfam:SSrecog 74 285 1.7e-105 PFAM
Rtt106 338 428 4.76e-41 SMART
low complexity region 469 481 N/A INTRINSIC
low complexity region 486 514 N/A INTRINSIC
low complexity region 521 542 N/A INTRINSIC
HMG 546 616 1.9e-27 SMART
low complexity region 621 691 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111613
SMART Domains Protein: ENSMUSP00000107240
Gene: ENSMUSG00000027071

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 372 4.7e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127069
Predicted Effect probably null
Transcript: ENSMUST00000130729
AA Change: Y311*
SMART Domains Protein: ENSMUSP00000121639
Gene: ENSMUSG00000027067
AA Change: Y311*

DomainStartEndE-ValueType
Pfam:SSrecog 74 285 5.7e-106 PFAM
Rtt106 338 428 4.76e-41 SMART
low complexity region 469 481 N/A INTRINSIC
low complexity region 486 514 N/A INTRINSIC
low complexity region 521 542 N/A INTRINSIC
HMG 546 616 1.9e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146530
Predicted Effect probably null
Transcript: ENSMUST00000168266
AA Change: Y311*
SMART Domains Protein: ENSMUSP00000127058
Gene: ENSMUSG00000027067
AA Change: Y311*

DomainStartEndE-ValueType
Pfam:SSrecog 75 284 8.8e-91 PFAM
Rtt106 338 428 4.76e-41 SMART
low complexity region 469 481 N/A INTRINSIC
low complexity region 486 514 N/A INTRINSIC
low complexity region 521 542 N/A INTRINSIC
HMG 546 616 1.9e-27 SMART
low complexity region 621 691 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of a heterodimer that, along with SUPT16H, forms chromatin transcriptional elongation factor FACT. FACT interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT and cisplatin-damaged DNA may be crucial to the anticancer mechanism of cisplatin. This encoded protein contains a high mobility group box which most likely constitutes the structure recognition element for cisplatin-modified DNA. This protein also functions as a co-activator of the transcriptional activator p63. An alternatively spliced transcript variant of this gene has been described, but its full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene is lethal resulting in death at some point between implantation and E5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,797,011 T538A possibly damaging Het
Acss2 A G 2: 155,574,616 probably benign Het
Ankef1 A G 2: 136,549,709 probably null Het
Arhgap20 T A 9: 51,816,727 M80K probably benign Het
Arhgap29 T G 3: 121,981,911 L37R probably damaging Het
Baiap3 G A 17: 25,244,785 P906S probably benign Het
Caskin2 T A 11: 115,802,289 N603I possibly damaging Het
Ccdc159 A T 9: 21,929,390 E84D probably benign Het
Ccl1 T G 11: 82,176,886 S73R possibly damaging Het
Cdh7 G T 1: 110,108,845 C585F probably damaging Het
Cga T C 4: 34,904,108 probably null Het
Coq5 A C 5: 115,279,882 E57A probably benign Het
Cstf1 T A 2: 172,377,833 L288Q probably damaging Het
Ctsll3 G T 13: 60,801,001 Q47K probably benign Het
Dchs1 T A 7: 105,771,596 Q539L probably benign Het
Fam205c G A 4: 42,873,087 T68I probably damaging Het
Fbxo46 C A 7: 19,136,495 D346E probably damaging Het
Frem3 A T 8: 80,615,778 T1567S probably damaging Het
Glce T A 9: 62,070,540 T21S probably damaging Het
Gm16432 G T 1: 178,122,762 silent Het
Gm19402 C T 10: 77,690,682 D26N probably damaging Het
Gm20830 A G Y: 6,916,664 Y152H probably damaging Het
Herc3 T C 6: 58,918,799 Y1011H probably benign Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Il31ra G T 13: 112,527,487 T552K possibly damaging Het
Itga2 A G 13: 114,884,506 V86A probably damaging Het
Kcnk4 A T 19: 6,928,355 N81K possibly damaging Het
Lrp2 C A 2: 69,466,877 D3247Y probably damaging Het
Maml3 G T 3: 52,104,132 F4L unknown Het
Mcpt1 A T 14: 56,018,615 H37L probably benign Het
Mpdz T C 4: 81,421,188 M1V probably null Het
Myom2 A T 8: 15,080,914 K283N possibly damaging Het
Nrxn1 C A 17: 90,643,224 R509L probably damaging Het
Ntng1 T A 3: 110,135,420 Y30F probably damaging Het
Olfr1098 C A 2: 86,923,205 G109V probably benign Het
Olfr676 A G 7: 105,036,156 probably null Het
Olfr891 C A 9: 38,180,718 C35F probably benign Het
Orc6 A T 8: 85,302,956 Q43L probably benign Het
Otogl G A 10: 107,857,001 S874L possibly damaging Het
Pcdh9 T C 14: 93,886,724 D670G probably damaging Het
Pcdhga9 A T 18: 37,738,806 I563F probably damaging Het
Plxna1 A T 6: 89,356,529 S373T probably damaging Het
Prop1 T C 11: 50,951,009 D190G probably damaging Het
Qrich1 T A 9: 108,534,115 Y280N probably damaging Het
Rasl10a T A 11: 5,059,519 D102E probably benign Het
Rgs1 T C 1: 144,245,372 Y187C probably damaging Het
Sema5b T A 16: 35,658,476 W557R probably damaging Het
Sh2b3 A T 5: 121,828,457 L198H probably damaging Het
Slc27a3 G T 3: 90,387,072 T429K probably benign Het
Slc35f1 T G 10: 53,089,450 D320E probably benign Het
Smug1 C A 15: 103,157,616 probably null Het
Svep1 T C 4: 58,096,223 T1466A possibly damaging Het
Tmem130 A G 5: 144,750,939 S196P probably damaging Het
Trim30d A T 7: 104,472,328 C176* probably null Het
Ush2a A G 1: 188,436,962 H1100R probably benign Het
Vezt A T 10: 93,997,095 F151L probably benign Het
Zc3h3 G T 15: 75,779,531 C638* probably null Het
Zfp128 C T 7: 12,884,727 R51C probably damaging Het
Zfp141 T G 7: 42,476,431 I206L possibly damaging Het
Zfp369 G T 13: 65,295,680 K324N probably benign Het
Other mutations in Ssrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Ssrp1 APN 2 85041099 splice site probably benign
IGL01935:Ssrp1 APN 2 85046712 makesense probably null
IGL02226:Ssrp1 APN 2 85040361 missense probably damaging 1.00
IGL02793:Ssrp1 APN 2 85040920 missense probably damaging 1.00
IGL02875:Ssrp1 APN 2 85040920 missense probably damaging 1.00
Dickcissel UTSW 2 85041634 missense probably damaging 0.96
Meadowlark UTSW 2 85041106 critical splice acceptor site probably null
PIT4131001:Ssrp1 UTSW 2 85038416 missense probably damaging 1.00
R0313:Ssrp1 UTSW 2 85041554 missense probably damaging 1.00
R0363:Ssrp1 UTSW 2 85040674 missense probably damaging 0.99
R1234:Ssrp1 UTSW 2 85042263 missense probably damaging 1.00
R1643:Ssrp1 UTSW 2 85041185 missense possibly damaging 0.89
R1713:Ssrp1 UTSW 2 85040760 missense probably damaging 0.99
R2049:Ssrp1 UTSW 2 85041427 splice site probably benign
R2113:Ssrp1 UTSW 2 85043006 splice site probably null
R2291:Ssrp1 UTSW 2 85042316 critical splice donor site probably null
R2471:Ssrp1 UTSW 2 85042298 missense possibly damaging 0.95
R2965:Ssrp1 UTSW 2 85041586 missense possibly damaging 0.46
R3552:Ssrp1 UTSW 2 85044392 missense probably benign
R4060:Ssrp1 UTSW 2 85041634 missense probably damaging 0.96
R4075:Ssrp1 UTSW 2 85045568 missense possibly damaging 0.68
R4131:Ssrp1 UTSW 2 85044447 missense probably null 0.28
R4326:Ssrp1 UTSW 2 85040217 intron probably benign
R4357:Ssrp1 UTSW 2 85041151 missense probably benign 0.22
R4400:Ssrp1 UTSW 2 85037941 missense probably damaging 0.97
R4797:Ssrp1 UTSW 2 85045722 nonsense probably null
R5293:Ssrp1 UTSW 2 85042252 nonsense probably null
R5571:Ssrp1 UTSW 2 85044325 missense probably damaging 0.99
R5592:Ssrp1 UTSW 2 85045519 missense probably benign 0.00
R5991:Ssrp1 UTSW 2 85042296 missense possibly damaging 0.94
R6019:Ssrp1 UTSW 2 85045452 missense probably damaging 1.00
R6133:Ssrp1 UTSW 2 85045339 intron probably benign
R6157:Ssrp1 UTSW 2 85040728 missense probably damaging 0.99
R6225:Ssrp1 UTSW 2 85042814 missense probably benign 0.02
R6551:Ssrp1 UTSW 2 85041106 critical splice acceptor site probably null
R6886:Ssrp1 UTSW 2 85039936 missense probably benign 0.04
R7189:Ssrp1 UTSW 2 85045562 missense probably benign 0.00
R7681:Ssrp1 UTSW 2 85045748 missense probably benign
R7789:Ssrp1 UTSW 2 85041181 missense probably damaging 1.00
X0023:Ssrp1 UTSW 2 85045475 missense probably benign 0.06
Z1088:Ssrp1 UTSW 2 85040653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAACTCGTTACCACTTC -3'
(R):5'- GTTGCCTATCACAAGGGCAC -3'

Sequencing Primer
(F):5'- CTCTTCTCCAAGGATGAGGAC -3'
(R):5'- AAGGGCACTCAGGCTTCTAC -3'
Posted On2016-11-21