Incidental Mutation 'R5743:Acss2'
ID445649
Institutional Source Beutler Lab
Gene Symbol Acss2
Ensembl Gene ENSMUSG00000027605
Gene Nameacyl-CoA synthetase short-chain family member 2
SynonymsAcas1, acetyl-CoA synthetase 1, Acas2, AceCS1, ACAS, Acs1
MMRRC Submission 043353-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R5743 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location155517948-155585724 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 155574616 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000065973] [ENSMUST00000079691] [ENSMUST00000126322] [ENSMUST00000130881] [ENSMUST00000155347]
Predicted Effect unknown
Transcript: ENSMUST00000065973
AA Change: N693S
SMART Domains Protein: ENSMUSP00000068776
Gene: ENSMUSG00000027605
AA Change: N693S

DomainStartEndE-ValueType
Pfam:AMP-binding 108 575 4.8e-98 PFAM
Pfam:AMP-binding_C 583 660 3.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079691
SMART Domains Protein: ENSMUSP00000078630
Gene: ENSMUSG00000027610

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 12 472 6.7e-131 PFAM
Pfam:GSH_synthase 204 302 2.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126322
SMART Domains Protein: ENSMUSP00000117266
Gene: ENSMUSG00000027610

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 1 197 1.2e-63 PFAM
Pfam:GSH_synthase 160 200 3.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130881
SMART Domains Protein: ENSMUSP00000135319
Gene: ENSMUSG00000027610

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 1 404 9.2e-130 PFAM
Pfam:GSH_synthase 133 233 9e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153975
Predicted Effect probably benign
Transcript: ENSMUST00000155347
SMART Domains Protein: ENSMUSP00000122662
Gene: ENSMUSG00000027610

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 5 179 1.8e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157008
Predicted Effect probably benign
Transcript: ENSMUST00000175993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176415
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic enzyme that catalyzes the activation of acetate for use in lipid synthesis and energy generation. The protein acts as a monomer and produces acetyl-CoA from acetate in a reaction that requires ATP. Expression of this gene is regulated by sterol regulatory element-binding proteins, transcription factors that activate genes required for the synthesis of cholesterol and unsaturated fatty acids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,797,011 T538A possibly damaging Het
Ankef1 A G 2: 136,549,709 probably null Het
Arhgap20 T A 9: 51,816,727 M80K probably benign Het
Arhgap29 T G 3: 121,981,911 L37R probably damaging Het
Baiap3 G A 17: 25,244,785 P906S probably benign Het
Caskin2 T A 11: 115,802,289 N603I possibly damaging Het
Ccdc159 A T 9: 21,929,390 E84D probably benign Het
Ccl1 T G 11: 82,176,886 S73R possibly damaging Het
Cdh7 G T 1: 110,108,845 C585F probably damaging Het
Cga T C 4: 34,904,108 probably null Het
Coq5 A C 5: 115,279,882 E57A probably benign Het
Cstf1 T A 2: 172,377,833 L288Q probably damaging Het
Ctsll3 G T 13: 60,801,001 Q47K probably benign Het
Dchs1 T A 7: 105,771,596 Q539L probably benign Het
Fam205c G A 4: 42,873,087 T68I probably damaging Het
Fbxo46 C A 7: 19,136,495 D346E probably damaging Het
Frem3 A T 8: 80,615,778 T1567S probably damaging Het
Glce T A 9: 62,070,540 T21S probably damaging Het
Gm16432 G T 1: 178,122,762 silent Het
Gm19402 C T 10: 77,690,682 D26N probably damaging Het
Gm20830 A G Y: 6,916,664 Y152H probably damaging Het
Herc3 T C 6: 58,918,799 Y1011H probably benign Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Il31ra G T 13: 112,527,487 T552K possibly damaging Het
Itga2 A G 13: 114,884,506 V86A probably damaging Het
Kcnk4 A T 19: 6,928,355 N81K possibly damaging Het
Lrp2 C A 2: 69,466,877 D3247Y probably damaging Het
Maml3 G T 3: 52,104,132 F4L unknown Het
Mcpt1 A T 14: 56,018,615 H37L probably benign Het
Mpdz T C 4: 81,421,188 M1V probably null Het
Myom2 A T 8: 15,080,914 K283N possibly damaging Het
Nrxn1 C A 17: 90,643,224 R509L probably damaging Het
Ntng1 T A 3: 110,135,420 Y30F probably damaging Het
Olfr1098 C A 2: 86,923,205 G109V probably benign Het
Olfr676 A G 7: 105,036,156 probably null Het
Olfr891 C A 9: 38,180,718 C35F probably benign Het
Orc6 A T 8: 85,302,956 Q43L probably benign Het
Otogl G A 10: 107,857,001 S874L possibly damaging Het
Pcdh9 T C 14: 93,886,724 D670G probably damaging Het
Pcdhga9 A T 18: 37,738,806 I563F probably damaging Het
Plxna1 A T 6: 89,356,529 S373T probably damaging Het
Prop1 T C 11: 50,951,009 D190G probably damaging Het
Qrich1 T A 9: 108,534,115 Y280N probably damaging Het
Rasl10a T A 11: 5,059,519 D102E probably benign Het
Rgs1 T C 1: 144,245,372 Y187C probably damaging Het
Sema5b T A 16: 35,658,476 W557R probably damaging Het
Sh2b3 A T 5: 121,828,457 L198H probably damaging Het
Slc27a3 G T 3: 90,387,072 T429K probably benign Het
Slc35f1 T G 10: 53,089,450 D320E probably benign Het
Smug1 C A 15: 103,157,616 probably null Het
Ssrp1 T A 2: 85,041,168 Y311* probably null Het
Svep1 T C 4: 58,096,223 T1466A possibly damaging Het
Tmem130 A G 5: 144,750,939 S196P probably damaging Het
Trim30d A T 7: 104,472,328 C176* probably null Het
Ush2a A G 1: 188,436,962 H1100R probably benign Het
Vezt A T 10: 93,997,095 F151L probably benign Het
Zc3h3 G T 15: 75,779,531 C638* probably null Het
Zfp128 C T 7: 12,884,727 R51C probably damaging Het
Zfp141 T G 7: 42,476,431 I206L possibly damaging Het
Zfp369 G T 13: 65,295,680 K324N probably benign Het
Other mutations in Acss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Acss2 APN 2 155562037 missense possibly damaging 0.83
IGL02333:Acss2 APN 2 155555884 missense probably damaging 1.00
IGL03278:Acss2 APN 2 155562001 missense possibly damaging 0.64
IGL03392:Acss2 APN 2 155562011 missense probably damaging 1.00
R1159:Acss2 UTSW 2 155551218 missense probably benign
R1293:Acss2 UTSW 2 155551221 missense probably benign
R1639:Acss2 UTSW 2 155556908 missense probably benign 0.01
R1725:Acss2 UTSW 2 155556844 missense possibly damaging 0.56
R1834:Acss2 UTSW 2 155558630 missense probably damaging 1.00
R1835:Acss2 UTSW 2 155558630 missense probably damaging 1.00
R1836:Acss2 UTSW 2 155558630 missense probably damaging 1.00
R2361:Acss2 UTSW 2 155558669 missense probably damaging 0.98
R3899:Acss2 UTSW 2 155557237 splice site probably benign
R4008:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4009:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4010:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4011:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4031:Acss2 UTSW 2 155557210 missense probably damaging 1.00
R4117:Acss2 UTSW 2 155556393 missense probably damaging 1.00
R4515:Acss2 UTSW 2 155556363 missense probably benign 0.39
R4756:Acss2 UTSW 2 155561143 missense probably damaging 1.00
R4895:Acss2 UTSW 2 155550481 splice site probably benign
R5327:Acss2 UTSW 2 155573229 missense probably null
R5654:Acss2 UTSW 2 155574655 unclassified probably benign
R5717:Acss2 UTSW 2 155561153 missense probably damaging 1.00
R5773:Acss2 UTSW 2 155574694 splice site probably null
R5825:Acss2 UTSW 2 155549178 unclassified probably null
R5979:Acss2 UTSW 2 155522109 missense possibly damaging 0.75
R6525:Acss2 UTSW 2 155550417 missense probably benign
R6551:Acss2 UTSW 2 155551208 missense probably benign
R6785:Acss2 UTSW 2 155560685 missense probably damaging 1.00
R6976:Acss2 UTSW 2 155556009 intron probably null
R7074:Acss2 UTSW 2 155522041 missense possibly damaging 0.94
R7372:Acss2 UTSW 2 155557180 missense probably damaging 0.99
R7448:Acss2 UTSW 2 155518266 missense probably damaging 1.00
R7528:Acss2 UTSW 2 155557146 missense probably damaging 1.00
R7541:Acss2 UTSW 2 155574690 critical splice donor site probably null
R7543:Acss2 UTSW 2 155549835 missense probably damaging 0.98
R7754:Acss2 UTSW 2 155561166 missense probably benign 0.00
R7846:Acss2 UTSW 2 155561033 missense probably damaging 1.00
R7929:Acss2 UTSW 2 155561033 missense probably damaging 1.00
R8011:Acss2 UTSW 2 155555957 missense possibly damaging 0.73
Z1177:Acss2 UTSW 2 155517957 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGTTTCAAACACAAGCCCTTCC -3'
(R):5'- CATGAGCAGAGTGGTTCAGG -3'

Sequencing Primer
(F):5'- ATAAGGCCAGTGTTTTACAGTGCC -3'
(R):5'- TGGTTCAGGGTACAAAGCG -3'
Posted On2016-11-21