Mutagenetix > Incidental Mutation

Incidental Mutation 'R5743:Ntng1'

445653

Institutional Source

Beutler Lab

Gene Symbol

Ntng1

Ensembl Gene

ENSMUSG00000059857

Gene Name

netrin G1

Synonyms

Lmnt1, A930010C08Rik

MMRRC Submission

043353-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5743 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109780040-110144011 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110135420 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 30 (Y30F)

Ref Sequence

ENSEMBL: ENSMUSP00000102185 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072596] [ENSMUST00000106570] [ENSMUST00000106571] [ENSMUST00000106575] [ENSMUST00000128219] [ENSMUST00000131027] [ENSMUST00000133268] [ENSMUST00000138344] [ENSMUST00000138953] [ENSMUST00000156177]

AlphaFold

Q8R4G0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072596
AA Change: Y30F

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000072397
Gene: ENSMUSG00000059857
AA Change: Y30F

Domain	Start	End	E-Value	Type
LamNT	59	295	3.22e-18	SMART
EGF_Lam	297	354	6.86e-4	SMART
EGF_Lam	364	417	4.81e-8	SMART
EGF_Lam	420	462	5.74e-6	SMART
EGF	466	498	5.12e-3	SMART
low complexity region	522	537	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106570
AA Change: Y30F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102180
Gene: ENSMUSG00000059857
AA Change: Y30F

Domain	Start	End	E-Value	Type
LamNT	59	295	3.22e-18	SMART
EGF_Lam	297	355	1.28e-3	SMART
EGF	388	420	5.12e-3	SMART
low complexity region	444	459	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106571
AA Change: Y30F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102181
Gene: ENSMUSG00000059857
AA Change: Y30F

Domain	Start	End	E-Value	Type
LamNT	59	295	3.22e-18	SMART
EGF_Lam	297	354	6.86e-4	SMART
EGF	408	440	5.12e-3	SMART
low complexity region	464	479	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106575
AA Change: Y30F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102185
Gene: ENSMUSG00000059857
AA Change: Y30F

Domain	Start	End	E-Value	Type
LamNT	59	295	3.22e-18	SMART
EGF_Lam	297	355	3.33e-2	SMART
EGF_Lam	364	417	4.81e-8	SMART
EGF_Lam	420	462	5.74e-6	SMART
EGF	466	498	5.12e-3	SMART
low complexity region	522	537	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000128219
AA Change: Y30F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116579
Gene: ENSMUSG00000059857
AA Change: Y30F

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
LamNT	59	295	1.5e-20	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131027
AA Change: Y30F

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000118800
Gene: ENSMUSG00000059857
AA Change: Y30F

Domain	Start	End	E-Value	Type
LamNT	59	295	3.22e-18	SMART
EGF_Lam	297	354	6.86e-4	SMART
EGF_Lam	364	417	4.81e-8	SMART
EGF	421	453	5.12e-3	SMART
low complexity region	477	492	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000133268
AA Change: Y30F

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000117371
Gene: ENSMUSG00000059857
AA Change: Y30F

Domain	Start	End	E-Value	Type
LamNT	59	295	3.22e-18	SMART
EGF_Lam	297	354	6.86e-4	SMART
EGF	365	397	5.12e-3	SMART
low complexity region	421	436	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138344
AA Change: Y30F

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000120688
Gene: ENSMUSG00000059857
AA Change: Y30F

Domain	Start	End	E-Value	Type
LamNT	59	295	3.22e-18	SMART
EGF_Lam	297	354	6.86e-4	SMART
EGF_Lam	364	406	5.74e-6	SMART
EGF	410	442	5.12e-3	SMART
low complexity region	466	481	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138953
AA Change: Y30F

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000116213
Gene: ENSMUSG00000059857
AA Change: Y30F

Domain	Start	End	E-Value	Type
LamNT	59	295	3.22e-18	SMART
EGF_Lam	297	354	6.86e-4	SMART
EGF	407	439	5.12e-3	SMART
low complexity region	463	478	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156177
AA Change: Y30F

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000119534
Gene: ENSMUSG00000059857
AA Change: Y30F

Domain	Start	End	E-Value	Type
LamNT	59	295	3.22e-18	SMART
EGF_Lam	297	354	6.86e-4	SMART
EGF	387	419	5.12e-3	SMART
low complexity region	443	458	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189335

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is processed into a secreted protein containing eukaroytic growth factor (EGF)-like domains. This protein acts to guide axon growth during neuronal development. Polymorphisms in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele survive into adulthood with no major alterations in gross brain cytoarchitecture or axonal projection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	A	G	7: 118,797,011	T538A	possibly damaging	Het
Acss2	A	G	2: 155,574,616		probably benign	Het
Ankef1	A	G	2: 136,549,709		probably null	Het
Arhgap20	T	A	9: 51,816,727	M80K	probably benign	Het
Arhgap29	T	G	3: 121,981,911	L37R	probably damaging	Het
Baiap3	G	A	17: 25,244,785	P906S	probably benign	Het
Caskin2	T	A	11: 115,802,289	N603I	possibly damaging	Het
Ccdc159	A	T	9: 21,929,390	E84D	probably benign	Het
Ccl1	T	G	11: 82,176,886	S73R	possibly damaging	Het
Cdh7	G	T	1: 110,108,845	C585F	probably damaging	Het
Cga	T	C	4: 34,904,108		probably null	Het
Coq5	A	C	5: 115,279,882	E57A	probably benign	Het
Cstf1	T	A	2: 172,377,833	L288Q	probably damaging	Het
Ctsll3	G	T	13: 60,801,001	Q47K	probably benign	Het
Dchs1	T	A	7: 105,771,596	Q539L	probably benign	Het
Fam205c	G	A	4: 42,873,087	T68I	probably damaging	Het
Fbxo46	C	A	7: 19,136,495	D346E	probably damaging	Het
Frem3	A	T	8: 80,615,778	T1567S	probably damaging	Het
Glce	T	A	9: 62,070,540	T21S	probably damaging	Het
Gm16432	G	T	1: 178,122,762		silent	Het
Gm19402	C	T	10: 77,690,682	D26N	probably damaging	Het
Gm20830	A	G	Y: 6,916,664	Y152H	probably damaging	Het
Herc3	T	C	6: 58,918,799	Y1011H	probably benign	Het
Igkv6-29	C	A	6: 70,138,600	G70V	possibly damaging	Het
Il31ra	G	T	13: 112,527,487	T552K	possibly damaging	Het
Itga2	A	G	13: 114,884,506	V86A	probably damaging	Het
Kcnk4	A	T	19: 6,928,355	N81K	possibly damaging	Het
Lrp2	C	A	2: 69,466,877	D3247Y	probably damaging	Het
Maml3	G	T	3: 52,104,132	F4L	unknown	Het
Mcpt1	A	T	14: 56,018,615	H37L	probably benign	Het
Mpdz	T	C	4: 81,421,188	M1V	probably null	Het
Myom2	A	T	8: 15,080,914	K283N	possibly damaging	Het
Nrxn1	C	A	17: 90,643,224	R509L	probably damaging	Het
Olfr1098	C	A	2: 86,923,205	G109V	probably benign	Het
Olfr676	A	G	7: 105,036,156		probably null	Het
Olfr891	C	A	9: 38,180,718	C35F	probably benign	Het
Orc6	A	T	8: 85,302,956	Q43L	probably benign	Het
Otogl	G	A	10: 107,857,001	S874L	possibly damaging	Het
Pcdh9	T	C	14: 93,886,724	D670G	probably damaging	Het
Pcdhga9	A	T	18: 37,738,806	I563F	probably damaging	Het
Plxna1	A	T	6: 89,356,529	S373T	probably damaging	Het
Prop1	T	C	11: 50,951,009	D190G	probably damaging	Het
Qrich1	T	A	9: 108,534,115	Y280N	probably damaging	Het
Rasl10a	T	A	11: 5,059,519	D102E	probably benign	Het
Rgs1	T	C	1: 144,245,372	Y187C	probably damaging	Het
Sema5b	T	A	16: 35,658,476	W557R	probably damaging	Het
Sh2b3	A	T	5: 121,828,457	L198H	probably damaging	Het
Slc27a3	G	T	3: 90,387,072	T429K	probably benign	Het
Slc35f1	T	G	10: 53,089,450	D320E	probably benign	Het
Smug1	C	A	15: 103,157,616		probably null	Het
Ssrp1	T	A	2: 85,041,168	Y311*	probably null	Het
Svep1	T	C	4: 58,096,223	T1466A	possibly damaging	Het
Tmem130	A	G	5: 144,750,939	S196P	probably damaging	Het
Trim30d	A	T	7: 104,472,328	C176*	probably null	Het
Ush2a	A	G	1: 188,436,962	H1100R	probably benign	Het
Vezt	A	T	10: 93,997,095	F151L	probably benign	Het
Zc3h3	G	T	15: 75,779,531	C638*	probably null	Het
Zfp128	C	T	7: 12,884,727	R51C	probably damaging	Het
Zfp141	T	G	7: 42,476,431	I206L	possibly damaging	Het
Zfp369	G	T	13: 65,295,680	K324N	probably benign	Het

Other mutations in Ntng1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02162:Ntng1	APN	3	109934995	nonsense	probably null
IGL02367:Ntng1	APN	3	110135513	splice site	probably null
IGL02448:Ntng1	APN	3	109934559	splice site	probably benign
IGL02487:Ntng1	APN	3	109935047	missense	probably damaging	0.98
IGL02500:Ntng1	APN	3	110135330	missense	probably damaging	1.00
IGL02578:Ntng1	APN	3	110135394	missense	probably benign	0.01
IGL03009:Ntng1	APN	3	109934702	missense	possibly damaging	0.89
IGL03096:Ntng1	APN	3	110135349	missense	probably benign	0.19
R0108:Ntng1	UTSW	3	109851755	splice site	probably benign
R0326:Ntng1	UTSW	3	110135503	nonsense	probably null
R0403:Ntng1	UTSW	3	109934611	missense	probably damaging	0.97
R0699:Ntng1	UTSW	3	109872295	missense	probably damaging	1.00
R0702:Ntng1	UTSW	3	109872254	missense	probably damaging	1.00
R1981:Ntng1	UTSW	3	109935010	missense	possibly damaging	0.61
R2096:Ntng1	UTSW	3	109832555	missense	probably damaging	0.99
R3739:Ntng1	UTSW	3	109934691	missense	probably damaging	1.00
R3963:Ntng1	UTSW	3	109934868	missense	probably damaging	1.00
R4484:Ntng1	UTSW	3	110143808	unclassified	probably benign
R4516:Ntng1	UTSW	3	109935013	missense	probably damaging	1.00
R4518:Ntng1	UTSW	3	109935013	missense	probably damaging	1.00
R4520:Ntng1	UTSW	3	109934996	missense	probably damaging	1.00
R4523:Ntng1	UTSW	3	109934996	missense	probably damaging	1.00
R4524:Ntng1	UTSW	3	109934996	missense	probably damaging	1.00
R4776:Ntng1	UTSW	3	109934713	missense	probably damaging	1.00
R4817:Ntng1	UTSW	3	109934868	missense	probably damaging	1.00
R4827:Ntng1	UTSW	3	110135411	missense	probably damaging	1.00
R4990:Ntng1	UTSW	3	110135261	critical splice donor site	probably null
R5067:Ntng1	UTSW	3	110135345	missense	possibly damaging	0.95
R5087:Ntng1	UTSW	3	110135329	nonsense	probably null
R5196:Ntng1	UTSW	3	109934983	missense	probably damaging	1.00
R5263:Ntng1	UTSW	3	109934872	missense	probably damaging	0.99
R6268:Ntng1	UTSW	3	109935035	missense	probably damaging	1.00
R6292:Ntng1	UTSW	3	110143886	unclassified	probably benign
R6419:Ntng1	UTSW	3	109782853	missense	possibly damaging	0.95
R6898:Ntng1	UTSW	3	109872218	missense	probably damaging	0.98
R7081:Ntng1	UTSW	3	109851789	missense	probably benign	0.00
R7090:Ntng1	UTSW	3	109935180	nonsense	probably null
R7134:Ntng1	UTSW	3	109935129	missense	probably benign
R7302:Ntng1	UTSW	3	109832617	missense	possibly damaging	0.94
R7353:Ntng1	UTSW	3	110135447	missense	probably damaging	1.00
R7408:Ntng1	UTSW	3	109853082	missense	probably benign	0.00
R7610:Ntng1	UTSW	3	109934825	missense	probably damaging	1.00
R7686:Ntng1	UTSW	3	109935014	missense	possibly damaging	0.80
R7972:Ntng1	UTSW	3	110135486	missense	probably benign	0.02
R9210:Ntng1	UTSW	3	109872317	missense	probably damaging	1.00
R9214:Ntng1	UTSW	3	109934605	missense	probably damaging	1.00
R9266:Ntng1	UTSW	3	110143607	unclassified	probably benign
R9266:Ntng1	UTSW	3	110143846	missense	unknown
R9364:Ntng1	UTSW	3	110135364	missense	probably damaging	0.97
R9593:Ntng1	UTSW	3	109934908	missense	probably damaging	1.00
R9596:Ntng1	UTSW	3	110135640	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTGCCTCACCATTGCACAG -3'
(R):5'- TGGAATCTGCTTTGAGATCTCAGC -3'

Sequencing Primer
(F):5'- CAGAAGGACTCTGGAGGGTCTC -3'
(R):5'- GATACATATAGACACGTGCACAC -3'

Posted On

2016-11-21