Incidental Mutation 'R5743:Arhgap29'
ID445654
Institutional Source Beutler Lab
Gene Symbol Arhgap29
Ensembl Gene ENSMUSG00000039831
Gene NameRho GTPase activating protein 29
SynonymsB130017I01Rik, 6720461J18Rik, C76601, Parg1
MMRRC Submission 043353-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5743 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location121952541-122016753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 121981911 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 37 (L37R)
Ref Sequence ENSEMBL: ENSMUSP00000143548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037958] [ENSMUST00000196479] [ENSMUST00000196904] [ENSMUST00000197155]
Predicted Effect probably damaging
Transcript: ENSMUST00000037958
AA Change: L101R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044624
Gene: ENSMUSG00000039831
AA Change: L101R

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
PDB:3QWE|A 193 469 5e-41 PDB
Blast:RhoGAP 412 595 9e-84 BLAST
C1 613 659 2.48e-6 SMART
RhoGAP 684 885 1.92e-68 SMART
low complexity region 947 961 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196479
AA Change: L37R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142817
Gene: ENSMUSG00000039831
AA Change: L37R

DomainStartEndE-ValueType
PDB:3QWE|A 129 271 1e-28 PDB
Blast:FCH 133 220 1e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000196904
AA Change: L37R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000197155
AA Change: L101R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142945
Gene: ENSMUSG00000039831
AA Change: L101R

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
PDB:3QWE|A 193 469 8e-42 PDB
Blast:RhoGAP 412 595 2e-87 BLAST
C1 613 659 2.48e-6 SMART
RhoGAP 684 780 1.14e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199081
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rap1 is a small GTPase that, through effectors, regulates Rho GTPase signaling. These effectors- Rasip1, Radil, and the protein encoded by this gene- translocate to the cell membrane, where they form a multiprotein complex. This complex is necessary for Rap1-induced inhibition of Rho signaling. Defects in this gene may be a cause of nonsyndromic cleft lip with or without cleft palate. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,797,011 T538A possibly damaging Het
Acss2 A G 2: 155,574,616 probably benign Het
Ankef1 A G 2: 136,549,709 probably null Het
Arhgap20 T A 9: 51,816,727 M80K probably benign Het
Baiap3 G A 17: 25,244,785 P906S probably benign Het
Caskin2 T A 11: 115,802,289 N603I possibly damaging Het
Ccdc159 A T 9: 21,929,390 E84D probably benign Het
Ccl1 T G 11: 82,176,886 S73R possibly damaging Het
Cdh7 G T 1: 110,108,845 C585F probably damaging Het
Cga T C 4: 34,904,108 probably null Het
Coq5 A C 5: 115,279,882 E57A probably benign Het
Cstf1 T A 2: 172,377,833 L288Q probably damaging Het
Ctsll3 G T 13: 60,801,001 Q47K probably benign Het
Dchs1 T A 7: 105,771,596 Q539L probably benign Het
Fam205c G A 4: 42,873,087 T68I probably damaging Het
Fbxo46 C A 7: 19,136,495 D346E probably damaging Het
Frem3 A T 8: 80,615,778 T1567S probably damaging Het
Glce T A 9: 62,070,540 T21S probably damaging Het
Gm16432 G T 1: 178,122,762 silent Het
Gm19402 C T 10: 77,690,682 D26N probably damaging Het
Gm20830 A G Y: 6,916,664 Y152H probably damaging Het
Herc3 T C 6: 58,918,799 Y1011H probably benign Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Il31ra G T 13: 112,527,487 T552K possibly damaging Het
Itga2 A G 13: 114,884,506 V86A probably damaging Het
Kcnk4 A T 19: 6,928,355 N81K possibly damaging Het
Lrp2 C A 2: 69,466,877 D3247Y probably damaging Het
Maml3 G T 3: 52,104,132 F4L unknown Het
Mcpt1 A T 14: 56,018,615 H37L probably benign Het
Mpdz T C 4: 81,421,188 M1V probably null Het
Myom2 A T 8: 15,080,914 K283N possibly damaging Het
Nrxn1 C A 17: 90,643,224 R509L probably damaging Het
Ntng1 T A 3: 110,135,420 Y30F probably damaging Het
Olfr1098 C A 2: 86,923,205 G109V probably benign Het
Olfr676 A G 7: 105,036,156 probably null Het
Olfr891 C A 9: 38,180,718 C35F probably benign Het
Orc6 A T 8: 85,302,956 Q43L probably benign Het
Otogl G A 10: 107,857,001 S874L possibly damaging Het
Pcdh9 T C 14: 93,886,724 D670G probably damaging Het
Pcdhga9 A T 18: 37,738,806 I563F probably damaging Het
Plxna1 A T 6: 89,356,529 S373T probably damaging Het
Prop1 T C 11: 50,951,009 D190G probably damaging Het
Qrich1 T A 9: 108,534,115 Y280N probably damaging Het
Rasl10a T A 11: 5,059,519 D102E probably benign Het
Rgs1 T C 1: 144,245,372 Y187C probably damaging Het
Sema5b T A 16: 35,658,476 W557R probably damaging Het
Sh2b3 A T 5: 121,828,457 L198H probably damaging Het
Slc27a3 G T 3: 90,387,072 T429K probably benign Het
Slc35f1 T G 10: 53,089,450 D320E probably benign Het
Smug1 C A 15: 103,157,616 probably null Het
Ssrp1 T A 2: 85,041,168 Y311* probably null Het
Svep1 T C 4: 58,096,223 T1466A possibly damaging Het
Tmem130 A G 5: 144,750,939 S196P probably damaging Het
Trim30d A T 7: 104,472,328 C176* probably null Het
Ush2a A G 1: 188,436,962 H1100R probably benign Het
Vezt A T 10: 93,997,095 F151L probably benign Het
Zc3h3 G T 15: 75,779,531 C638* probably null Het
Zfp128 C T 7: 12,884,727 R51C probably damaging Het
Zfp141 T G 7: 42,476,431 I206L possibly damaging Het
Zfp369 G T 13: 65,295,680 K324N probably benign Het
Other mutations in Arhgap29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Arhgap29 APN 3 122003312 nonsense probably null
IGL01121:Arhgap29 APN 3 122009863 missense probably damaging 1.00
IGL01622:Arhgap29 APN 3 121974124 splice site probably benign
IGL01623:Arhgap29 APN 3 121974124 splice site probably benign
IGL01995:Arhgap29 APN 3 122014328 missense probably benign 0.00
IGL02120:Arhgap29 APN 3 122004257 missense probably benign 0.05
IGL02554:Arhgap29 APN 3 121992524 unclassified probably benign
IGL02931:Arhgap29 APN 3 121992860 missense probably benign
IGL02937:Arhgap29 APN 3 121974049 missense probably damaging 0.99
PIT4362001:Arhgap29 UTSW 3 122003212 missense probably benign 0.42
R0022:Arhgap29 UTSW 3 121988937 missense possibly damaging 0.61
R0574:Arhgap29 UTSW 3 122007625 missense probably benign 0.01
R0601:Arhgap29 UTSW 3 121991110 missense probably damaging 1.00
R0639:Arhgap29 UTSW 3 122007641 missense probably damaging 1.00
R0881:Arhgap29 UTSW 3 122014679 missense probably damaging 1.00
R1232:Arhgap29 UTSW 3 122003340 missense probably damaging 1.00
R1295:Arhgap29 UTSW 3 121992395 missense probably benign 0.27
R1296:Arhgap29 UTSW 3 121992395 missense probably benign 0.27
R1403:Arhgap29 UTSW 3 121973929 missense probably damaging 1.00
R1403:Arhgap29 UTSW 3 121973929 missense probably damaging 1.00
R1470:Arhgap29 UTSW 3 121992319 unclassified probably benign
R1710:Arhgap29 UTSW 3 122008080 missense probably damaging 1.00
R1878:Arhgap29 UTSW 3 122011371 missense probably damaging 1.00
R2051:Arhgap29 UTSW 3 121981860 missense probably benign 0.01
R2112:Arhgap29 UTSW 3 122011561 missense probably benign 0.03
R2188:Arhgap29 UTSW 3 121991009 missense probably damaging 1.00
R2240:Arhgap29 UTSW 3 122011453 missense probably benign 0.12
R2420:Arhgap29 UTSW 3 121973980 missense probably benign
R3618:Arhgap29 UTSW 3 121988527 missense possibly damaging 0.62
R4673:Arhgap29 UTSW 3 122014971 missense probably damaging 1.00
R4717:Arhgap29 UTSW 3 122009958 missense possibly damaging 0.82
R5028:Arhgap29 UTSW 3 122010060 critical splice donor site probably null
R5043:Arhgap29 UTSW 3 121974004 missense probably benign 0.00
R5045:Arhgap29 UTSW 3 122002595 missense probably benign 0.28
R5463:Arhgap29 UTSW 3 121988551 missense possibly damaging 0.94
R5495:Arhgap29 UTSW 3 122014929 missense probably damaging 1.00
R5791:Arhgap29 UTSW 3 122014245 missense probably damaging 0.98
R5896:Arhgap29 UTSW 3 122012087 missense possibly damaging 0.78
R6083:Arhgap29 UTSW 3 121992748 missense probably benign 0.00
R6355:Arhgap29 UTSW 3 122011258 missense possibly damaging 0.46
R6451:Arhgap29 UTSW 3 121993581 missense probably damaging 1.00
R6528:Arhgap29 UTSW 3 122014702 missense probably benign 0.13
R7239:Arhgap29 UTSW 3 121988950 missense probably benign 0.16
R7669:Arhgap29 UTSW 3 121992812 missense probably damaging 1.00
R7807:Arhgap29 UTSW 3 122014332 missense probably benign 0.01
R8048:Arhgap29 UTSW 3 121992901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAACCAGTGCTTTCTACTCTAAG -3'
(R):5'- CCCAAGCTGTCAAACTTCGG -3'

Sequencing Primer
(F):5'- CTACTCTAAGTAGCTTTGTGATGTC -3'
(R):5'- AGGTAACCTTTTCTTCTGGTAAGTC -3'
Posted On2016-11-21