Mutagenetix > Incidental Mutations

Incidental Mutation 'R5743:Arhgap29'

445654

Institutional Source

Beutler Lab

Gene Symbol

Arhgap29

Ensembl Gene

ENSMUSG00000039831

Gene Name

Rho GTPase activating protein 29

Synonyms

B130017I01Rik, 6720461J18Rik, C76601, Parg1

MMRRC Submission

043353-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5743 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121952541-122016753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 121981911 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 37 (L37R)

Ref Sequence

ENSEMBL: ENSMUSP00000143548 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037958] [ENSMUST00000196479] [ENSMUST00000196904] [ENSMUST00000197155]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037958
AA Change: L101R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044624
Gene: ENSMUSG00000039831
AA Change: L101R

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	5e-41	PDB
Blast:RhoGAP	412	595	9e-84	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	885	1.92e-68	SMART
low complexity region	947	961	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000196479
AA Change: L37R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142817
Gene: ENSMUSG00000039831
AA Change: L37R

Domain	Start	End	E-Value	Type
PDB:3QWE\|A	129	271	1e-28	PDB
Blast:FCH	133	220	1e-10	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000196904
AA Change: L37R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000197155
AA Change: L101R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142945
Gene: ENSMUSG00000039831
AA Change: L101R

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	8e-42	PDB
Blast:RhoGAP	412	595	2e-87	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	780	1.14e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199081

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rap1 is a small GTPase that, through effectors, regulates Rho GTPase signaling. These effectors- Rasip1, Radil, and the protein encoded by this gene- translocate to the cell membrane, where they form a multiprotein complex. This complex is necessary for Rap1-induced inhibition of Rho signaling. Defects in this gene may be a cause of nonsyndromic cleft lip with or without cleft palate. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	A	G	7: 118,797,011	T538A	possibly damaging	Het
Acss2	A	G	2: 155,574,616		probably benign	Het
Ankef1	A	G	2: 136,549,709		probably null	Het
Arhgap20	T	A	9: 51,816,727	M80K	probably benign	Het
Baiap3	G	A	17: 25,244,785	P906S	probably benign	Het
Caskin2	T	A	11: 115,802,289	N603I	possibly damaging	Het
Ccdc159	A	T	9: 21,929,390	E84D	probably benign	Het
Ccl1	T	G	11: 82,176,886	S73R	possibly damaging	Het
Cdh7	G	T	1: 110,108,845	C585F	probably damaging	Het
Cga	T	C	4: 34,904,108		probably null	Het
Coq5	A	C	5: 115,279,882	E57A	probably benign	Het
Cstf1	T	A	2: 172,377,833	L288Q	probably damaging	Het
Ctsll3	G	T	13: 60,801,001	Q47K	probably benign	Het
Dchs1	T	A	7: 105,771,596	Q539L	probably benign	Het
Fam205c	G	A	4: 42,873,087	T68I	probably damaging	Het
Fbxo46	C	A	7: 19,136,495	D346E	probably damaging	Het
Frem3	A	T	8: 80,615,778	T1567S	probably damaging	Het
Glce	T	A	9: 62,070,540	T21S	probably damaging	Het
Gm16432	G	T	1: 178,122,762		silent	Het
Gm19402	C	T	10: 77,690,682	D26N	probably damaging	Het
Gm20830	A	G	Y: 6,916,664	Y152H	probably damaging	Het
Herc3	T	C	6: 58,918,799	Y1011H	probably benign	Het
Igkv6-29	C	A	6: 70,138,600	G70V	possibly damaging	Het
Il31ra	G	T	13: 112,527,487	T552K	possibly damaging	Het
Itga2	A	G	13: 114,884,506	V86A	probably damaging	Het
Kcnk4	A	T	19: 6,928,355	N81K	possibly damaging	Het
Lrp2	C	A	2: 69,466,877	D3247Y	probably damaging	Het
Maml3	G	T	3: 52,104,132	F4L	unknown	Het
Mcpt1	A	T	14: 56,018,615	H37L	probably benign	Het
Mpdz	T	C	4: 81,421,188	M1V	probably null	Het
Myom2	A	T	8: 15,080,914	K283N	possibly damaging	Het
Nrxn1	C	A	17: 90,643,224	R509L	probably damaging	Het
Ntng1	T	A	3: 110,135,420	Y30F	probably damaging	Het
Olfr1098	C	A	2: 86,923,205	G109V	probably benign	Het
Olfr676	A	G	7: 105,036,156		probably null	Het
Olfr891	C	A	9: 38,180,718	C35F	probably benign	Het
Orc6	A	T	8: 85,302,956	Q43L	probably benign	Het
Otogl	G	A	10: 107,857,001	S874L	possibly damaging	Het
Pcdh9	T	C	14: 93,886,724	D670G	probably damaging	Het
Pcdhga9	A	T	18: 37,738,806	I563F	probably damaging	Het
Plxna1	A	T	6: 89,356,529	S373T	probably damaging	Het
Prop1	T	C	11: 50,951,009	D190G	probably damaging	Het
Qrich1	T	A	9: 108,534,115	Y280N	probably damaging	Het
Rasl10a	T	A	11: 5,059,519	D102E	probably benign	Het
Rgs1	T	C	1: 144,245,372	Y187C	probably damaging	Het
Sema5b	T	A	16: 35,658,476	W557R	probably damaging	Het
Sh2b3	A	T	5: 121,828,457	L198H	probably damaging	Het
Slc27a3	G	T	3: 90,387,072	T429K	probably benign	Het
Slc35f1	T	G	10: 53,089,450	D320E	probably benign	Het
Smug1	C	A	15: 103,157,616		probably null	Het
Ssrp1	T	A	2: 85,041,168	Y311*	probably null	Het
Svep1	T	C	4: 58,096,223	T1466A	possibly damaging	Het
Tmem130	A	G	5: 144,750,939	S196P	probably damaging	Het
Trim30d	A	T	7: 104,472,328	C176*	probably null	Het
Ush2a	A	G	1: 188,436,962	H1100R	probably benign	Het
Vezt	A	T	10: 93,997,095	F151L	probably benign	Het
Zc3h3	G	T	15: 75,779,531	C638*	probably null	Het
Zfp128	C	T	7: 12,884,727	R51C	probably damaging	Het
Zfp141	T	G	7: 42,476,431	I206L	possibly damaging	Het
Zfp369	G	T	13: 65,295,680	K324N	probably benign	Het

Other mutations in Arhgap29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Arhgap29	APN	3	122003312	nonsense	probably null
IGL01121:Arhgap29	APN	3	122009863	missense	probably damaging	1.00
IGL01622:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01623:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01995:Arhgap29	APN	3	122014328	missense	probably benign	0.00
IGL02120:Arhgap29	APN	3	122004257	missense	probably benign	0.05
IGL02554:Arhgap29	APN	3	121992524	unclassified	probably benign
IGL02931:Arhgap29	APN	3	121992860	missense	probably benign
IGL02937:Arhgap29	APN	3	121974049	missense	probably damaging	0.99
PIT4362001:Arhgap29	UTSW	3	122003212	missense	probably benign	0.42
R0022:Arhgap29	UTSW	3	121988937	missense	possibly damaging	0.61
R0574:Arhgap29	UTSW	3	122007625	missense	probably benign	0.01
R0601:Arhgap29	UTSW	3	121991110	missense	probably damaging	1.00
R0639:Arhgap29	UTSW	3	122007641	missense	probably damaging	1.00
R0881:Arhgap29	UTSW	3	122014679	missense	probably damaging	1.00
R1232:Arhgap29	UTSW	3	122003340	missense	probably damaging	1.00
R1295:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1296:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1470:Arhgap29	UTSW	3	121992319	unclassified	probably benign
R1710:Arhgap29	UTSW	3	122008080	missense	probably damaging	1.00
R1878:Arhgap29	UTSW	3	122011371	missense	probably damaging	1.00
R2051:Arhgap29	UTSW	3	121981860	missense	probably benign	0.01
R2112:Arhgap29	UTSW	3	122011561	missense	probably benign	0.03
R2188:Arhgap29	UTSW	3	121991009	missense	probably damaging	1.00
R2240:Arhgap29	UTSW	3	122011453	missense	probably benign	0.12
R2420:Arhgap29	UTSW	3	121973980	missense	probably benign
R3618:Arhgap29	UTSW	3	121988527	missense	possibly damaging	0.62
R4673:Arhgap29	UTSW	3	122014971	missense	probably damaging	1.00
R4717:Arhgap29	UTSW	3	122009958	missense	possibly damaging	0.82
R5028:Arhgap29	UTSW	3	122010060	critical splice donor site	probably null
R5043:Arhgap29	UTSW	3	121974004	missense	probably benign	0.00
R5045:Arhgap29	UTSW	3	122002595	missense	probably benign	0.28
R5463:Arhgap29	UTSW	3	121988551	missense	possibly damaging	0.94
R5495:Arhgap29	UTSW	3	122014929	missense	probably damaging	1.00
R5791:Arhgap29	UTSW	3	122014245	missense	probably damaging	0.98
R5896:Arhgap29	UTSW	3	122012087	missense	possibly damaging	0.78
R6083:Arhgap29	UTSW	3	121992748	missense	probably benign	0.00
R6355:Arhgap29	UTSW	3	122011258	missense	possibly damaging	0.46
R6451:Arhgap29	UTSW	3	121993581	missense	probably damaging	1.00
R6528:Arhgap29	UTSW	3	122014702	missense	probably benign	0.13
R7239:Arhgap29	UTSW	3	121988950	missense	probably benign	0.16
R7669:Arhgap29	UTSW	3	121992812	missense	probably damaging	1.00
R7807:Arhgap29	UTSW	3	122014332	missense	probably benign	0.01
R8048:Arhgap29	UTSW	3	121992901	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGAACCAGTGCTTTCTACTCTAAG -3'
(R):5'- CCCAAGCTGTCAAACTTCGG -3'

Sequencing Primer
(F):5'- CTACTCTAAGTAGCTTTGTGATGTC -3'
(R):5'- AGGTAACCTTTTCTTCTGGTAAGTC -3'

Posted On

2016-11-21