Mutagenetix > Incidental Mutations

Incidental Mutation 'R5743:Mpdz'

445657

Institutional Source

Beutler Lab

Gene Symbol

Mpdz

Ensembl Gene

ENSMUSG00000028402

Gene Name

multiple PDZ domain protein

Synonyms

B930003D11Rik, MUPP1

MMRRC Submission

043353-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5743 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81278500-81442815 bp(-) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

T to C at 81421188 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1 (M1V)

Ref Sequence

ENSEMBL: ENSMUSP00000102879 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102830] [ENSMUST00000107258] [ENSMUST00000107262] [ENSMUST00000220807]

Predicted Effect

probably null
Transcript: ENSMUST00000102830
AA Change: M1V

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099894
Gene: ENSMUSG00000028402
AA Change: M1V

Domain	Start	End	E-Value	Type
L27	6	66	9.04e-3	SMART
PDZ	147	225	3.03e-23	SMART
PDZ	266	338	8.92e-21	SMART
low complexity region	345	360	N/A	INTRINSIC
PDZ	386	464	6.07e-23	SMART
PDZ	556	627	7.31e-17	SMART
PDZ	701	780	9.94e-19	SMART
PDZ	1004	1080	3.44e-13	SMART
low complexity region	1111	1126	N/A	INTRINSIC
PDZ	1148	1231	2.43e-22	SMART
low complexity region	1233	1251	N/A	INTRINSIC
PDZ	1346	1421	3.41e-17	SMART
low complexity region	1434	1445	N/A	INTRINSIC
low complexity region	1454	1468	N/A	INTRINSIC
PDZ	1479	1552	2.69e-15	SMART
PDZ	1622	1697	3.2e-22	SMART
PDZ	1719	1792	3.62e-21	SMART
low complexity region	1798	1815	N/A	INTRINSIC
PDZ	1856	1933	9.79e-18	SMART
PDZ	1980	2055	2.39e-21	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000107258
AA Change: M1V

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000102879
Gene: ENSMUSG00000028402
AA Change: M1V

Domain	Start	End	E-Value	Type
PDZ	1	73	3.42e-8	SMART
low complexity region	104	119	N/A	INTRINSIC
PDZ	141	224	2.43e-22	SMART
PDZ	306	381	3.41e-17	SMART
low complexity region	394	405	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
PDZ	439	512	2.69e-15	SMART
PDZ	582	657	3.2e-22	SMART
PDZ	679	752	3.62e-21	SMART
low complexity region	758	775	N/A	INTRINSIC
PDZ	816	893	9.79e-18	SMART
PDZ	940	1015	2.39e-21	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000107262
AA Change: M1V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000102883
Gene: ENSMUSG00000028402
AA Change: M1V

Domain	Start	End	E-Value	Type
L27	6	66	9.04e-3	SMART
PDZ	147	225	3.03e-23	SMART
PDZ	266	338	8.92e-21	SMART
low complexity region	345	360	N/A	INTRINSIC
PDZ	386	464	6.07e-23	SMART
PDZ	556	627	7.31e-17	SMART
PDZ	701	780	9.94e-19	SMART
PDZ	1004	1080	3.44e-13	SMART
low complexity region	1112	1127	N/A	INTRINSIC
PDZ	1149	1232	2.43e-22	SMART
low complexity region	1234	1252	N/A	INTRINSIC
PDZ	1347	1422	3.41e-17	SMART
low complexity region	1435	1446	N/A	INTRINSIC
low complexity region	1455	1469	N/A	INTRINSIC
PDZ	1480	1553	2.69e-15	SMART
PDZ	1623	1698	3.2e-22	SMART
PDZ	1720	1793	3.62e-21	SMART
low complexity region	1799	1816	N/A	INTRINSIC
PDZ	1857	1934	9.79e-18	SMART
PDZ	1981	2056	2.39e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142273

Predicted Effect

probably null
Transcript: ENSMUST00000220807
AA Change: M1V

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has multiple PDZ domains, which are hallmarks of protein-protein interactions. The encoded protein is known to interact with the HTR2C receptor and may cause it to clump at the cell surface. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mutant heterozygous mice are more sensitive to ethanol withdrawal effects and consume less alcohol than controls. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	A	G	7: 118,797,011	T538A	possibly damaging	Het
Acss2	A	G	2: 155,574,616		probably benign	Het
Ankef1	A	G	2: 136,549,709		probably null	Het
Arhgap20	T	A	9: 51,816,727	M80K	probably benign	Het
Arhgap29	T	G	3: 121,981,911	L37R	probably damaging	Het
Baiap3	G	A	17: 25,244,785	P906S	probably benign	Het
Caskin2	T	A	11: 115,802,289	N603I	possibly damaging	Het
Ccdc159	A	T	9: 21,929,390	E84D	probably benign	Het
Ccl1	T	G	11: 82,176,886	S73R	possibly damaging	Het
Cdh7	G	T	1: 110,108,845	C585F	probably damaging	Het
Cga	T	C	4: 34,904,108		probably null	Het
Coq5	A	C	5: 115,279,882	E57A	probably benign	Het
Cstf1	T	A	2: 172,377,833	L288Q	probably damaging	Het
Ctsll3	G	T	13: 60,801,001	Q47K	probably benign	Het
Dchs1	T	A	7: 105,771,596	Q539L	probably benign	Het
Fam205c	G	A	4: 42,873,087	T68I	probably damaging	Het
Fbxo46	C	A	7: 19,136,495	D346E	probably damaging	Het
Frem3	A	T	8: 80,615,778	T1567S	probably damaging	Het
Glce	T	A	9: 62,070,540	T21S	probably damaging	Het
Gm16432	G	T	1: 178,122,762		silent	Het
Gm19402	C	T	10: 77,690,682	D26N	probably damaging	Het
Gm20830	A	G	Y: 6,916,664	Y152H	probably damaging	Het
Herc3	T	C	6: 58,918,799	Y1011H	probably benign	Het
Igkv6-29	C	A	6: 70,138,600	G70V	possibly damaging	Het
Il31ra	G	T	13: 112,527,487	T552K	possibly damaging	Het
Itga2	A	G	13: 114,884,506	V86A	probably damaging	Het
Kcnk4	A	T	19: 6,928,355	N81K	possibly damaging	Het
Lrp2	C	A	2: 69,466,877	D3247Y	probably damaging	Het
Maml3	G	T	3: 52,104,132	F4L	unknown	Het
Mcpt1	A	T	14: 56,018,615	H37L	probably benign	Het
Myom2	A	T	8: 15,080,914	K283N	possibly damaging	Het
Nrxn1	C	A	17: 90,643,224	R509L	probably damaging	Het
Ntng1	T	A	3: 110,135,420	Y30F	probably damaging	Het
Olfr1098	C	A	2: 86,923,205	G109V	probably benign	Het
Olfr676	A	G	7: 105,036,156		probably null	Het
Olfr891	C	A	9: 38,180,718	C35F	probably benign	Het
Orc6	A	T	8: 85,302,956	Q43L	probably benign	Het
Otogl	G	A	10: 107,857,001	S874L	possibly damaging	Het
Pcdh9	T	C	14: 93,886,724	D670G	probably damaging	Het
Pcdhga9	A	T	18: 37,738,806	I563F	probably damaging	Het
Plxna1	A	T	6: 89,356,529	S373T	probably damaging	Het
Prop1	T	C	11: 50,951,009	D190G	probably damaging	Het
Qrich1	T	A	9: 108,534,115	Y280N	probably damaging	Het
Rasl10a	T	A	11: 5,059,519	D102E	probably benign	Het
Rgs1	T	C	1: 144,245,372	Y187C	probably damaging	Het
Sema5b	T	A	16: 35,658,476	W557R	probably damaging	Het
Sh2b3	A	T	5: 121,828,457	L198H	probably damaging	Het
Slc27a3	G	T	3: 90,387,072	T429K	probably benign	Het
Slc35f1	T	G	10: 53,089,450	D320E	probably benign	Het
Smug1	C	A	15: 103,157,616		probably null	Het
Ssrp1	T	A	2: 85,041,168	Y311*	probably null	Het
Svep1	T	C	4: 58,096,223	T1466A	possibly damaging	Het
Tmem130	A	G	5: 144,750,939	S196P	probably damaging	Het
Trim30d	A	T	7: 104,472,328	C176*	probably null	Het
Ush2a	A	G	1: 188,436,962	H1100R	probably benign	Het
Vezt	A	T	10: 93,997,095	F151L	probably benign	Het
Zc3h3	G	T	15: 75,779,531	C638*	probably null	Het
Zfp128	C	T	7: 12,884,727	R51C	probably damaging	Het
Zfp141	T	G	7: 42,476,431	I206L	possibly damaging	Het
Zfp369	G	T	13: 65,295,680	K324N	probably benign	Het

Other mutations in Mpdz

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Mpdz	APN	4	81310224	nonsense	probably null
IGL00325:Mpdz	APN	4	81317631	missense	probably damaging	1.00
IGL00497:Mpdz	APN	4	81335742	missense	probably benign	0.30
IGL00502:Mpdz	APN	4	81369723	missense	probably damaging	1.00
IGL00539:Mpdz	APN	4	81361351	missense	possibly damaging	0.83
IGL00938:Mpdz	APN	4	81292512	missense	probably damaging	1.00
IGL00990:Mpdz	APN	4	81303584	splice site	probably benign
IGL01394:Mpdz	APN	4	81292491	missense	possibly damaging	0.92
IGL01537:Mpdz	APN	4	81369658	missense	probably damaging	0.98
IGL01558:Mpdz	APN	4	81295530	nonsense	probably null
IGL01561:Mpdz	APN	4	81284614	missense	probably damaging	1.00
IGL01649:Mpdz	APN	4	81303633	missense	probably damaging	0.98
IGL01743:Mpdz	APN	4	81317682	missense	probably damaging	1.00
IGL01941:Mpdz	APN	4	81286387	missense	possibly damaging	0.91
IGL01969:Mpdz	APN	4	81358724	missense	probably damaging	0.98
IGL02023:Mpdz	APN	4	81329529	missense	probably damaging	0.99
IGL02081:Mpdz	APN	4	81335869	missense	probably damaging	1.00
IGL02304:Mpdz	APN	4	81310157	missense	possibly damaging	0.78
IGL02304:Mpdz	APN	4	81297559	splice site	probably benign
IGL02410:Mpdz	APN	4	81297493	missense	probably benign	0.13
IGL02449:Mpdz	APN	4	81329422	splice site	probably null
IGL02671:Mpdz	APN	4	81290273	missense	probably damaging	1.00
IGL02708:Mpdz	APN	4	81284571	splice site	probably null
IGL02718:Mpdz	APN	4	81385202	missense	probably damaging	1.00
IGL03065:Mpdz	APN	4	81292565	missense	probably damaging	0.98
IGL03378:Mpdz	APN	4	81419048	splice site	probably benign
PIT4458001:Mpdz	UTSW	4	81419026	missense	probably damaging	1.00
R0108:Mpdz	UTSW	4	81381805	missense	probably damaging	1.00
R0108:Mpdz	UTSW	4	81381805	missense	probably damaging	1.00
R0119:Mpdz	UTSW	4	81292531	missense	probably benign	0.44
R0402:Mpdz	UTSW	4	81361440	missense	possibly damaging	0.51
R0499:Mpdz	UTSW	4	81292531	missense	probably benign	0.44
R0718:Mpdz	UTSW	4	81292473	missense	possibly damaging	0.79
R0844:Mpdz	UTSW	4	81421194	start gained	probably benign
R0883:Mpdz	UTSW	4	81359991	splice site	probably benign
R0885:Mpdz	UTSW	4	81369592	missense	probably benign	0.04
R1344:Mpdz	UTSW	4	81308319	missense	probably benign	0.01
R1432:Mpdz	UTSW	4	81292551	missense	probably damaging	1.00
R1488:Mpdz	UTSW	4	81348708	nonsense	probably null
R1589:Mpdz	UTSW	4	81421176	missense	probably benign	0.00
R1756:Mpdz	UTSW	4	81306877	missense	possibly damaging	0.87
R1940:Mpdz	UTSW	4	81361443	missense	probably benign	0.01
R2068:Mpdz	UTSW	4	81335830	missense	probably null	1.00
R2182:Mpdz	UTSW	4	81348722	missense	probably damaging	1.00
R2213:Mpdz	UTSW	4	81310172	missense	probably damaging	0.99
R2265:Mpdz	UTSW	4	81383391	missense	probably damaging	1.00
R2268:Mpdz	UTSW	4	81383391	missense	probably damaging	1.00
R2269:Mpdz	UTSW	4	81383391	missense	probably damaging	1.00
R3082:Mpdz	UTSW	4	81285458	splice site	probably benign
R3746:Mpdz	UTSW	4	81363147	missense	probably damaging	1.00
R3902:Mpdz	UTSW	4	81307116	missense	probably damaging	1.00
R4095:Mpdz	UTSW	4	81383823	missense	possibly damaging	0.77
R4097:Mpdz	UTSW	4	81335700	missense	probably damaging	1.00
R4206:Mpdz	UTSW	4	81381762	missense	probably benign	0.13
R4675:Mpdz	UTSW	4	81383812	missense	probably damaging	0.98
R4884:Mpdz	UTSW	4	81361476	missense	probably damaging	0.97
R5044:Mpdz	UTSW	4	81381697	missense	probably benign	0.16
R5050:Mpdz	UTSW	4	81295448	missense	probably benign	0.00
R5243:Mpdz	UTSW	4	81306879	missense	probably damaging	1.00
R5332:Mpdz	UTSW	4	81292580	missense	probably damaging	1.00
R5435:Mpdz	UTSW	4	81283487	intron	probably benign
R5720:Mpdz	UTSW	4	81287694	missense	probably damaging	0.99
R5764:Mpdz	UTSW	4	81356446	missense	probably benign	0.13
R5876:Mpdz	UTSW	4	81285474	nonsense	probably null
R5938:Mpdz	UTSW	4	81284614	missense	probably damaging	1.00
R5988:Mpdz	UTSW	4	81284575	critical splice donor site	probably null
R6125:Mpdz	UTSW	4	81297527	missense	probably benign	0.00
R6178:Mpdz	UTSW	4	81308365	missense	probably damaging	1.00
R6235:Mpdz	UTSW	4	81385281	missense	probably damaging	1.00
R6293:Mpdz	UTSW	4	81360056	missense	probably damaging	1.00
R6387:Mpdz	UTSW	4	81381709	missense	possibly damaging	0.69
R6488:Mpdz	UTSW	4	81287733	missense	probably benign	0.11
R6536:Mpdz	UTSW	4	81383417	missense	probably damaging	1.00
R6673:Mpdz	UTSW	4	81356430	missense	probably benign	0.11
R6879:Mpdz	UTSW	4	81348656	missense	possibly damaging	0.81
R7180:Mpdz	UTSW	4	81335751	missense	probably damaging	0.98
R7199:Mpdz	UTSW	4	81297333	missense	probably damaging	0.98
R7209:Mpdz	UTSW	4	81306877	missense	possibly damaging	0.87
R7309:Mpdz	UTSW	4	81381958	intron	probably null
R7359:Mpdz	UTSW	4	81356395	missense	probably benign	0.01
R7561:Mpdz	UTSW	4	81307151	missense	probably damaging	0.99
R7565:Mpdz	UTSW	4	81303654	missense	probably benign	0.01
R7738:Mpdz	UTSW	4	81335749	missense	probably benign	0.01
R8074:Mpdz	UTSW	4	81349087	missense	probably benign	0.00
RF013:Mpdz	UTSW	4	81293592	missense	possibly damaging	0.60
X0011:Mpdz	UTSW	4	81292759	critical splice donor site	probably null
Z1177:Mpdz	UTSW	4	81320490	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACAATGTGGATAAAACTGCACG -3'
(R):5'- ACTGTTGCAACTAGTGGGAAC -3'

Sequencing Primer
(F):5'- TGTGGATAAAACTGCACGAATAG -3'
(R):5'- CTCCAGAAGAGGGAGTCATATCTC -3'

Posted On

2016-11-21