Incidental Mutation 'R5743:Herc3'
ID 445661
Institutional Source Beutler Lab
Gene Symbol Herc3
Ensembl Gene ENSMUSG00000029804
Gene Name hect domain and RLD 3
Synonyms 5730409F18Rik
MMRRC Submission 043353-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5743 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 58808450-58897383 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58895784 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1011 (Y1011H)
Ref Sequence ENSEMBL: ENSMUSP00000040025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041401]
AlphaFold A6H6S0
Predicted Effect probably benign
Transcript: ENSMUST00000041401
AA Change: Y1011H

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000040025
Gene: ENSMUSG00000029804
AA Change: Y1011H

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.7e-11 PFAM
Pfam:RCC1 52 99 1.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 7.3e-16 PFAM
Pfam:RCC1_2 139 168 1.3e-9 PFAM
Pfam:RCC1 155 205 1.4e-16 PFAM
Pfam:RCC1_2 193 221 5e-10 PFAM
Pfam:RCC1 208 257 1.4e-16 PFAM
Pfam:RCC1_2 244 273 6.1e-8 PFAM
Pfam:RCC1 260 309 1.7e-14 PFAM
Pfam:RCC1_2 296 326 1.1e-7 PFAM
Pfam:RCC1 313 377 6.6e-11 PFAM
HECTc 721 1050 5.79e-157 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131132
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the HERC ubiquitin ligase family. The encoded protein is located in the cytosol and binds ubiquitin via a HECT domain. Mutations in this gene have been associated with colorectal and gastric carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hair follicle bulge morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,416,536 (GRCm39) probably benign Het
Ankef1 A G 2: 136,391,629 (GRCm39) probably null Het
Arhgap20 T A 9: 51,728,027 (GRCm39) M80K probably benign Het
Arhgap29 T G 3: 121,775,560 (GRCm39) L37R probably damaging Het
Baiap3 G A 17: 25,463,759 (GRCm39) P906S probably benign Het
Caskin2 T A 11: 115,693,115 (GRCm39) N603I possibly damaging Het
Catspere2 G T 1: 177,950,328 (GRCm39) silent Het
Ccdc159 A T 9: 21,840,686 (GRCm39) E84D probably benign Het
Ccl1 T G 11: 82,067,712 (GRCm39) S73R possibly damaging Het
Cdh20 G T 1: 110,036,575 (GRCm39) C585F probably damaging Het
Cga T C 4: 34,904,108 (GRCm39) probably null Het
Coq5 A C 5: 115,417,941 (GRCm39) E57A probably benign Het
Cstf1 T A 2: 172,219,753 (GRCm39) L288Q probably damaging Het
Ctsll3 G T 13: 60,948,815 (GRCm39) Q47K probably benign Het
Dchs1 T A 7: 105,420,803 (GRCm39) Q539L probably benign Het
Fbxo46 C A 7: 18,870,420 (GRCm39) D346E probably damaging Het
Frem3 A T 8: 81,342,407 (GRCm39) T1567S probably damaging Het
Glce T A 9: 61,977,822 (GRCm39) T21S probably damaging Het
Gm19402 C T 10: 77,526,516 (GRCm39) D26N probably damaging Het
Gm20830 A G Y: 6,916,664 (GRCm39) Y152H probably damaging Het
Igkv6-29 C A 6: 70,115,584 (GRCm39) G70V possibly damaging Het
Il31ra G T 13: 112,664,021 (GRCm39) T552K possibly damaging Het
Itga2 A G 13: 115,021,042 (GRCm39) V86A probably damaging Het
Kcnk4 A T 19: 6,905,723 (GRCm39) N81K possibly damaging Het
Lrp2 C A 2: 69,297,221 (GRCm39) D3247Y probably damaging Het
Maml3 G T 3: 52,011,553 (GRCm39) F4L unknown Het
Mcpt1 A T 14: 56,256,072 (GRCm39) H37L probably benign Het
Mpdz T C 4: 81,339,425 (GRCm39) M1V probably null Het
Myom2 A T 8: 15,130,914 (GRCm39) K283N possibly damaging Het
Nrxn1 C A 17: 90,950,652 (GRCm39) R509L probably damaging Het
Ntng1 T A 3: 110,042,736 (GRCm39) Y30F probably damaging Het
Or52e7 A G 7: 104,685,363 (GRCm39) probably null Het
Or8c13 C A 9: 38,092,014 (GRCm39) C35F probably benign Het
Or8h8 C A 2: 86,753,549 (GRCm39) G109V probably benign Het
Orc6 A T 8: 86,029,585 (GRCm39) Q43L probably benign Het
Otogl G A 10: 107,692,862 (GRCm39) S874L possibly damaging Het
Pcdh9 T C 14: 94,124,160 (GRCm39) D670G probably damaging Het
Pcdhga9 A T 18: 37,871,859 (GRCm39) I563F probably damaging Het
Plxna1 A T 6: 89,333,511 (GRCm39) S373T probably damaging Het
Prop1 T C 11: 50,841,836 (GRCm39) D190G probably damaging Het
Qrich1 T A 9: 108,411,314 (GRCm39) Y280N probably damaging Het
Rasl10a T A 11: 5,009,519 (GRCm39) D102E probably benign Het
Rgs1 T C 1: 144,121,110 (GRCm39) Y187C probably damaging Het
Sema5b T A 16: 35,478,846 (GRCm39) W557R probably damaging Het
Sh2b3 A T 5: 121,966,520 (GRCm39) L198H probably damaging Het
Slc27a3 G T 3: 90,294,379 (GRCm39) T429K probably benign Het
Slc35f1 T G 10: 52,965,546 (GRCm39) D320E probably benign Het
Smug1 C A 15: 103,066,043 (GRCm39) probably null Het
Spata31f3 G A 4: 42,873,087 (GRCm39) T68I probably damaging Het
Ssrp1 T A 2: 84,871,512 (GRCm39) Y311* probably null Het
Svep1 T C 4: 58,096,223 (GRCm39) T1466A possibly damaging Het
Tmem130 A G 5: 144,687,749 (GRCm39) S196P probably damaging Het
Trim30d A T 7: 104,121,535 (GRCm39) C176* probably null Het
Ush2a A G 1: 188,169,159 (GRCm39) H1100R probably benign Het
Vezt A T 10: 93,832,957 (GRCm39) F151L probably benign Het
Vps35l A G 7: 118,396,234 (GRCm39) T538A possibly damaging Het
Zc3h3 G T 15: 75,651,380 (GRCm39) C638* probably null Het
Zfp128 C T 7: 12,618,654 (GRCm39) R51C probably damaging Het
Zfp141 T G 7: 42,125,855 (GRCm39) I206L possibly damaging Het
Zfp369 G T 13: 65,443,494 (GRCm39) K324N probably benign Het
Other mutations in Herc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Herc3 APN 6 58,851,248 (GRCm39) missense probably damaging 1.00
IGL00423:Herc3 APN 6 58,845,700 (GRCm39) missense probably damaging 0.99
IGL00468:Herc3 APN 6 58,895,751 (GRCm39) missense probably benign 0.04
IGL01153:Herc3 APN 6 58,837,321 (GRCm39) missense probably benign 0.21
IGL01468:Herc3 APN 6 58,831,880 (GRCm39) missense probably benign 0.00
IGL01696:Herc3 APN 6 58,837,371 (GRCm39) missense possibly damaging 0.58
IGL01975:Herc3 APN 6 58,893,561 (GRCm39) missense possibly damaging 0.91
IGL02797:Herc3 APN 6 58,845,679 (GRCm39) missense probably benign
IGL02953:Herc3 APN 6 58,834,718 (GRCm39) nonsense probably null
aegean UTSW 6 58,832,745 (GRCm39) nonsense probably null
PIT4519001:Herc3 UTSW 6 58,853,796 (GRCm39) missense probably damaging 1.00
R0019:Herc3 UTSW 6 58,862,050 (GRCm39) splice site probably benign
R0019:Herc3 UTSW 6 58,862,050 (GRCm39) splice site probably benign
R0025:Herc3 UTSW 6 58,851,293 (GRCm39) missense probably damaging 1.00
R0025:Herc3 UTSW 6 58,851,293 (GRCm39) missense probably damaging 1.00
R0268:Herc3 UTSW 6 58,845,613 (GRCm39) splice site probably benign
R0334:Herc3 UTSW 6 58,895,802 (GRCm39) missense probably damaging 1.00
R0344:Herc3 UTSW 6 58,845,613 (GRCm39) splice site probably benign
R0853:Herc3 UTSW 6 58,853,549 (GRCm39) missense probably damaging 1.00
R0927:Herc3 UTSW 6 58,845,748 (GRCm39) missense possibly damaging 0.48
R1333:Herc3 UTSW 6 58,864,478 (GRCm39) missense probably damaging 1.00
R1432:Herc3 UTSW 6 58,893,827 (GRCm39) missense possibly damaging 0.49
R1450:Herc3 UTSW 6 58,853,500 (GRCm39) nonsense probably null
R1594:Herc3 UTSW 6 58,864,569 (GRCm39) unclassified probably benign
R1757:Herc3 UTSW 6 58,893,455 (GRCm39) missense probably damaging 1.00
R1765:Herc3 UTSW 6 58,865,645 (GRCm39) missense probably damaging 0.99
R1932:Herc3 UTSW 6 58,853,778 (GRCm39) missense probably damaging 0.99
R1945:Herc3 UTSW 6 58,864,424 (GRCm39) missense probably damaging 0.96
R1988:Herc3 UTSW 6 58,861,960 (GRCm39) critical splice donor site probably null
R2172:Herc3 UTSW 6 58,864,422 (GRCm39) missense probably damaging 1.00
R3080:Herc3 UTSW 6 58,833,631 (GRCm39) splice site probably null
R3545:Herc3 UTSW 6 58,833,670 (GRCm39) missense probably damaging 1.00
R3767:Herc3 UTSW 6 58,853,587 (GRCm39) missense probably benign 0.00
R3767:Herc3 UTSW 6 58,839,973 (GRCm39) missense probably benign
R3805:Herc3 UTSW 6 58,893,835 (GRCm39) missense probably damaging 1.00
R3806:Herc3 UTSW 6 58,893,835 (GRCm39) missense probably damaging 1.00
R4049:Herc3 UTSW 6 58,853,822 (GRCm39) missense probably damaging 0.99
R4250:Herc3 UTSW 6 58,893,501 (GRCm39) missense probably damaging 1.00
R4469:Herc3 UTSW 6 58,853,794 (GRCm39) nonsense probably null
R4534:Herc3 UTSW 6 58,837,332 (GRCm39) missense probably benign
R4573:Herc3 UTSW 6 58,871,098 (GRCm39) missense possibly damaging 0.89
R4887:Herc3 UTSW 6 58,864,484 (GRCm39) missense probably damaging 1.00
R5047:Herc3 UTSW 6 58,832,745 (GRCm39) nonsense probably null
R5049:Herc3 UTSW 6 58,871,524 (GRCm39) splice site probably null
R5062:Herc3 UTSW 6 58,832,745 (GRCm39) nonsense probably null
R5063:Herc3 UTSW 6 58,832,745 (GRCm39) nonsense probably null
R5288:Herc3 UTSW 6 58,851,263 (GRCm39) missense probably damaging 0.99
R5297:Herc3 UTSW 6 58,833,626 (GRCm39) missense probably damaging 1.00
R5386:Herc3 UTSW 6 58,851,263 (GRCm39) missense probably damaging 0.99
R5435:Herc3 UTSW 6 58,832,791 (GRCm39) missense probably damaging 1.00
R5576:Herc3 UTSW 6 58,865,710 (GRCm39) missense probably benign 0.08
R5605:Herc3 UTSW 6 58,834,712 (GRCm39) missense probably damaging 1.00
R5719:Herc3 UTSW 6 58,871,528 (GRCm39) missense possibly damaging 0.67
R5870:Herc3 UTSW 6 58,893,435 (GRCm39) missense probably benign 0.01
R6460:Herc3 UTSW 6 58,867,108 (GRCm39) missense probably damaging 1.00
R6930:Herc3 UTSW 6 58,893,444 (GRCm39) missense probably damaging 0.98
R7034:Herc3 UTSW 6 58,853,840 (GRCm39) missense probably benign 0.00
R7131:Herc3 UTSW 6 58,864,409 (GRCm39) missense probably damaging 1.00
R7187:Herc3 UTSW 6 58,833,616 (GRCm39) missense probably benign 0.42
R7212:Herc3 UTSW 6 58,895,758 (GRCm39) missense probably damaging 1.00
R7335:Herc3 UTSW 6 58,853,773 (GRCm39) missense possibly damaging 0.95
R7349:Herc3 UTSW 6 58,835,971 (GRCm39) missense probably benign
R7568:Herc3 UTSW 6 58,820,795 (GRCm39) missense probably benign 0.01
R7857:Herc3 UTSW 6 58,820,637 (GRCm39) nonsense probably null
R8321:Herc3 UTSW 6 58,820,754 (GRCm39) missense possibly damaging 0.93
R8672:Herc3 UTSW 6 58,850,786 (GRCm39) missense probably damaging 0.96
R8684:Herc3 UTSW 6 58,864,561 (GRCm39) missense probably damaging 1.00
R8968:Herc3 UTSW 6 58,867,183 (GRCm39) missense probably damaging 1.00
R8994:Herc3 UTSW 6 58,851,328 (GRCm39) missense probably benign 0.11
R9219:Herc3 UTSW 6 58,871,552 (GRCm39) missense probably benign 0.01
R9434:Herc3 UTSW 6 58,853,846 (GRCm39) missense probably benign 0.00
R9562:Herc3 UTSW 6 58,835,999 (GRCm39) missense probably null 0.01
R9565:Herc3 UTSW 6 58,835,999 (GRCm39) missense probably null 0.01
Z1176:Herc3 UTSW 6 58,820,843 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTAGGGCATGTCTAGTGCATATG -3'
(R):5'- TTCAGCCTCAATGTGGCCAC -3'

Sequencing Primer
(F):5'- GGTACCTAAAGAGCATTGTAGTTCCC -3'
(R):5'- GCCTCAATGTGGCCACAGAAG -3'
Posted On 2016-11-21