Incidental Mutation 'R5743:Zfp141'
ID445667
Institutional Source Beutler Lab
Gene Symbol Zfp141
Ensembl Gene ENSMUSG00000092416
Gene Namezinc finger protein 141
Synonyms
MMRRC Submission 043353-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5743 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location42473386-42505740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 42476431 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 206 (I206L)
Ref Sequence ENSEMBL: ENSMUSP00000133899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173489] [ENSMUST00000174407]
Predicted Effect probably benign
Transcript: ENSMUST00000173489
Predicted Effect possibly damaging
Transcript: ENSMUST00000174407
AA Change: I206L

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133899
Gene: ENSMUSG00000092416
AA Change: I206L

DomainStartEndE-ValueType
KRAB 18 78 4.41e-34 SMART
internal_repeat_1 146 405 8.73e-7 PROSPERO
ZnF_C2H2 410 432 4.54e-4 SMART
ZnF_C2H2 438 460 2.2e-2 SMART
ZnF_C2H2 466 488 2.95e-3 SMART
ZnF_C2H2 494 516 4.24e-4 SMART
ZnF_C2H2 522 544 9.58e-3 SMART
ZnF_C2H2 550 572 4.01e-5 SMART
ZnF_C2H2 578 600 3.21e-4 SMART
ZnF_C2H2 606 628 4.87e-4 SMART
ZnF_C2H2 634 656 5.99e-4 SMART
ZnF_C2H2 662 684 4.87e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174489
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in abnormal skin pigmentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,797,011 T538A possibly damaging Het
Acss2 A G 2: 155,574,616 probably benign Het
Ankef1 A G 2: 136,549,709 probably null Het
Arhgap20 T A 9: 51,816,727 M80K probably benign Het
Arhgap29 T G 3: 121,981,911 L37R probably damaging Het
Baiap3 G A 17: 25,244,785 P906S probably benign Het
Caskin2 T A 11: 115,802,289 N603I possibly damaging Het
Ccdc159 A T 9: 21,929,390 E84D probably benign Het
Ccl1 T G 11: 82,176,886 S73R possibly damaging Het
Cdh7 G T 1: 110,108,845 C585F probably damaging Het
Cga T C 4: 34,904,108 probably null Het
Coq5 A C 5: 115,279,882 E57A probably benign Het
Cstf1 T A 2: 172,377,833 L288Q probably damaging Het
Ctsll3 G T 13: 60,801,001 Q47K probably benign Het
Dchs1 T A 7: 105,771,596 Q539L probably benign Het
Fam205c G A 4: 42,873,087 T68I probably damaging Het
Fbxo46 C A 7: 19,136,495 D346E probably damaging Het
Frem3 A T 8: 80,615,778 T1567S probably damaging Het
Glce T A 9: 62,070,540 T21S probably damaging Het
Gm16432 G T 1: 178,122,762 silent Het
Gm19402 C T 10: 77,690,682 D26N probably damaging Het
Gm20830 A G Y: 6,916,664 Y152H probably damaging Het
Herc3 T C 6: 58,918,799 Y1011H probably benign Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Il31ra G T 13: 112,527,487 T552K possibly damaging Het
Itga2 A G 13: 114,884,506 V86A probably damaging Het
Kcnk4 A T 19: 6,928,355 N81K possibly damaging Het
Lrp2 C A 2: 69,466,877 D3247Y probably damaging Het
Maml3 G T 3: 52,104,132 F4L unknown Het
Mcpt1 A T 14: 56,018,615 H37L probably benign Het
Mpdz T C 4: 81,421,188 M1V probably null Het
Myom2 A T 8: 15,080,914 K283N possibly damaging Het
Nrxn1 C A 17: 90,643,224 R509L probably damaging Het
Ntng1 T A 3: 110,135,420 Y30F probably damaging Het
Olfr1098 C A 2: 86,923,205 G109V probably benign Het
Olfr676 A G 7: 105,036,156 probably null Het
Olfr891 C A 9: 38,180,718 C35F probably benign Het
Orc6 A T 8: 85,302,956 Q43L probably benign Het
Otogl G A 10: 107,857,001 S874L possibly damaging Het
Pcdh9 T C 14: 93,886,724 D670G probably damaging Het
Pcdhga9 A T 18: 37,738,806 I563F probably damaging Het
Plxna1 A T 6: 89,356,529 S373T probably damaging Het
Prop1 T C 11: 50,951,009 D190G probably damaging Het
Qrich1 T A 9: 108,534,115 Y280N probably damaging Het
Rasl10a T A 11: 5,059,519 D102E probably benign Het
Rgs1 T C 1: 144,245,372 Y187C probably damaging Het
Sema5b T A 16: 35,658,476 W557R probably damaging Het
Sh2b3 A T 5: 121,828,457 L198H probably damaging Het
Slc27a3 G T 3: 90,387,072 T429K probably benign Het
Slc35f1 T G 10: 53,089,450 D320E probably benign Het
Smug1 C A 15: 103,157,616 probably null Het
Ssrp1 T A 2: 85,041,168 Y311* probably null Het
Svep1 T C 4: 58,096,223 T1466A possibly damaging Het
Tmem130 A G 5: 144,750,939 S196P probably damaging Het
Trim30d A T 7: 104,472,328 C176* probably null Het
Ush2a A G 1: 188,436,962 H1100R probably benign Het
Vezt A T 10: 93,997,095 F151L probably benign Het
Zc3h3 G T 15: 75,779,531 C638* probably null Het
Zfp128 C T 7: 12,884,727 R51C probably damaging Het
Zfp369 G T 13: 65,295,680 K324N probably benign Het
Other mutations in Zfp141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Zfp141 APN 7 42475307 nonsense probably null
IGL00595:Zfp141 APN 7 42476655 missense probably benign 0.08
R0577:Zfp141 UTSW 7 42476514 missense probably benign 0.14
R0883:Zfp141 UTSW 7 42476056 missense possibly damaging 0.85
R1701:Zfp141 UTSW 7 42476046 missense probably benign 0.35
R2290:Zfp141 UTSW 7 42475225 missense probably damaging 1.00
R4176:Zfp141 UTSW 7 42476281 missense probably benign 0.04
R4719:Zfp141 UTSW 7 42476687 splice site probably null
R4897:Zfp141 UTSW 7 42476205 missense probably benign 0.24
R5372:Zfp141 UTSW 7 42477196 missense possibly damaging 0.91
R5438:Zfp141 UTSW 7 42489470 missense probably damaging 1.00
R5447:Zfp141 UTSW 7 42475559 nonsense probably null
R5969:Zfp141 UTSW 7 42489488 missense probably damaging 0.98
R6731:Zfp141 UTSW 7 42489500 missense probably damaging 0.99
R7127:Zfp141 UTSW 7 42475429 missense probably damaging 1.00
R7474:Zfp141 UTSW 7 42476254 nonsense probably null
R7572:Zfp141 UTSW 7 42475432 missense probably benign 0.03
R7830:Zfp141 UTSW 7 42475188 missense probably benign 0.01
R7890:Zfp141 UTSW 7 42476479 missense probably damaging 0.99
R7973:Zfp141 UTSW 7 42476479 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATTCAACAGAGACTTTGCTGTAC -3'
(R):5'- CGTGAAAGCCATCATTGGTTGG -3'

Sequencing Primer
(F):5'- CAACAGAGACTTTGCTGTACTTATC -3'
(R):5'- GGGTATTTCTGAATACTGCCACAG -3'
Posted On2016-11-21