Incidental Mutation 'R5743:Myom2'
ID 445671
Institutional Source Beutler Lab
Gene Symbol Myom2
Ensembl Gene ENSMUSG00000031461
Gene Name myomesin 2
Synonyms
MMRRC Submission 043353-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.149) question?
Stock # R5743 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 15107653-15183410 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 15130914 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 283 (K283N)
Ref Sequence ENSEMBL: ENSMUSP00000033842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033842]
AlphaFold Q14BI5
Predicted Effect possibly damaging
Transcript: ENSMUST00000033842
AA Change: K283N

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461
AA Change: K283N

DomainStartEndE-ValueType
low complexity region 34 63 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
coiled coil region 97 129 N/A INTRINSIC
IG 160 247 7.7e-5 SMART
IG 284 373 8.01e-3 SMART
FN3 383 466 1.5e-14 SMART
FN3 511 594 1.79e-12 SMART
FN3 612 693 1.95e-13 SMART
FN3 711 794 8.69e-11 SMART
FN3 813 896 1.86e-10 SMART
IG_like 913 999 1.58e2 SMART
Blast:IG_like 1021 1106 1e-44 BLAST
IG_like 1135 1215 2.27e1 SMART
Blast:IG_like 1227 1321 9e-51 BLAST
IGc2 1357 1425 4.96e-8 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,416,536 (GRCm39) probably benign Het
Ankef1 A G 2: 136,391,629 (GRCm39) probably null Het
Arhgap20 T A 9: 51,728,027 (GRCm39) M80K probably benign Het
Arhgap29 T G 3: 121,775,560 (GRCm39) L37R probably damaging Het
Baiap3 G A 17: 25,463,759 (GRCm39) P906S probably benign Het
Caskin2 T A 11: 115,693,115 (GRCm39) N603I possibly damaging Het
Catspere2 G T 1: 177,950,328 (GRCm39) silent Het
Ccdc159 A T 9: 21,840,686 (GRCm39) E84D probably benign Het
Ccl1 T G 11: 82,067,712 (GRCm39) S73R possibly damaging Het
Cdh20 G T 1: 110,036,575 (GRCm39) C585F probably damaging Het
Cga T C 4: 34,904,108 (GRCm39) probably null Het
Coq5 A C 5: 115,417,941 (GRCm39) E57A probably benign Het
Cstf1 T A 2: 172,219,753 (GRCm39) L288Q probably damaging Het
Ctsll3 G T 13: 60,948,815 (GRCm39) Q47K probably benign Het
Dchs1 T A 7: 105,420,803 (GRCm39) Q539L probably benign Het
Fbxo46 C A 7: 18,870,420 (GRCm39) D346E probably damaging Het
Frem3 A T 8: 81,342,407 (GRCm39) T1567S probably damaging Het
Glce T A 9: 61,977,822 (GRCm39) T21S probably damaging Het
Gm19402 C T 10: 77,526,516 (GRCm39) D26N probably damaging Het
Gm20830 A G Y: 6,916,664 (GRCm39) Y152H probably damaging Het
Herc3 T C 6: 58,895,784 (GRCm39) Y1011H probably benign Het
Igkv6-29 C A 6: 70,115,584 (GRCm39) G70V possibly damaging Het
Il31ra G T 13: 112,664,021 (GRCm39) T552K possibly damaging Het
Itga2 A G 13: 115,021,042 (GRCm39) V86A probably damaging Het
Kcnk4 A T 19: 6,905,723 (GRCm39) N81K possibly damaging Het
Lrp2 C A 2: 69,297,221 (GRCm39) D3247Y probably damaging Het
Maml3 G T 3: 52,011,553 (GRCm39) F4L unknown Het
Mcpt1 A T 14: 56,256,072 (GRCm39) H37L probably benign Het
Mpdz T C 4: 81,339,425 (GRCm39) M1V probably null Het
Nrxn1 C A 17: 90,950,652 (GRCm39) R509L probably damaging Het
Ntng1 T A 3: 110,042,736 (GRCm39) Y30F probably damaging Het
Or52e7 A G 7: 104,685,363 (GRCm39) probably null Het
Or8c13 C A 9: 38,092,014 (GRCm39) C35F probably benign Het
Or8h8 C A 2: 86,753,549 (GRCm39) G109V probably benign Het
Orc6 A T 8: 86,029,585 (GRCm39) Q43L probably benign Het
Otogl G A 10: 107,692,862 (GRCm39) S874L possibly damaging Het
Pcdh9 T C 14: 94,124,160 (GRCm39) D670G probably damaging Het
Pcdhga9 A T 18: 37,871,859 (GRCm39) I563F probably damaging Het
Plxna1 A T 6: 89,333,511 (GRCm39) S373T probably damaging Het
Prop1 T C 11: 50,841,836 (GRCm39) D190G probably damaging Het
Qrich1 T A 9: 108,411,314 (GRCm39) Y280N probably damaging Het
Rasl10a T A 11: 5,009,519 (GRCm39) D102E probably benign Het
Rgs1 T C 1: 144,121,110 (GRCm39) Y187C probably damaging Het
Sema5b T A 16: 35,478,846 (GRCm39) W557R probably damaging Het
Sh2b3 A T 5: 121,966,520 (GRCm39) L198H probably damaging Het
Slc27a3 G T 3: 90,294,379 (GRCm39) T429K probably benign Het
Slc35f1 T G 10: 52,965,546 (GRCm39) D320E probably benign Het
Smug1 C A 15: 103,066,043 (GRCm39) probably null Het
Spata31f3 G A 4: 42,873,087 (GRCm39) T68I probably damaging Het
Ssrp1 T A 2: 84,871,512 (GRCm39) Y311* probably null Het
Svep1 T C 4: 58,096,223 (GRCm39) T1466A possibly damaging Het
Tmem130 A G 5: 144,687,749 (GRCm39) S196P probably damaging Het
Trim30d A T 7: 104,121,535 (GRCm39) C176* probably null Het
Ush2a A G 1: 188,169,159 (GRCm39) H1100R probably benign Het
Vezt A T 10: 93,832,957 (GRCm39) F151L probably benign Het
Vps35l A G 7: 118,396,234 (GRCm39) T538A possibly damaging Het
Zc3h3 G T 15: 75,651,380 (GRCm39) C638* probably null Het
Zfp128 C T 7: 12,618,654 (GRCm39) R51C probably damaging Het
Zfp141 T G 7: 42,125,855 (GRCm39) I206L possibly damaging Het
Zfp369 G T 13: 65,443,494 (GRCm39) K324N probably benign Het
Other mutations in Myom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom2 APN 8 15,119,490 (GRCm39) missense probably damaging 1.00
IGL00426:Myom2 APN 8 15,119,502 (GRCm39) missense probably benign 0.00
IGL00503:Myom2 APN 8 15,164,289 (GRCm39) splice site probably null
IGL01515:Myom2 APN 8 15,172,655 (GRCm39) missense probably benign 0.15
IGL01649:Myom2 APN 8 15,163,755 (GRCm39) missense probably benign 0.24
IGL01658:Myom2 APN 8 15,127,880 (GRCm39) missense probably damaging 1.00
IGL01786:Myom2 APN 8 15,156,330 (GRCm39) missense probably damaging 0.99
IGL01924:Myom2 APN 8 15,119,685 (GRCm39) missense probably benign 0.37
IGL01929:Myom2 APN 8 15,167,698 (GRCm39) missense probably damaging 0.96
IGL02016:Myom2 APN 8 15,175,195 (GRCm39) missense probably benign 0.01
IGL02511:Myom2 APN 8 15,115,743 (GRCm39) missense probably benign
IGL02558:Myom2 APN 8 15,164,237 (GRCm39) missense probably benign 0.31
IGL02944:Myom2 APN 8 15,154,065 (GRCm39) critical splice acceptor site probably null
IGL03052:Myom2 APN 8 15,173,442 (GRCm39) splice site probably benign
IGL03195:Myom2 APN 8 15,161,844 (GRCm39) nonsense probably null
IGL03288:Myom2 APN 8 15,172,679 (GRCm39) missense probably damaging 0.99
IGL03402:Myom2 APN 8 15,115,731 (GRCm39) missense probably benign
yomama UTSW 8 15,182,895 (GRCm39) missense probably benign 0.10
yoyoma UTSW 8 15,182,667 (GRCm39) missense probably damaging 0.99
R0069:Myom2 UTSW 8 15,167,624 (GRCm39) missense probably benign
R0116:Myom2 UTSW 8 15,167,633 (GRCm39) missense probably damaging 1.00
R0131:Myom2 UTSW 8 15,133,329 (GRCm39) missense probably damaging 0.98
R0373:Myom2 UTSW 8 15,148,419 (GRCm39) missense possibly damaging 0.91
R0463:Myom2 UTSW 8 15,154,123 (GRCm39) missense probably benign 0.09
R0544:Myom2 UTSW 8 15,119,796 (GRCm39) missense probably damaging 1.00
R0629:Myom2 UTSW 8 15,119,783 (GRCm39) missense probably damaging 0.98
R0634:Myom2 UTSW 8 15,169,216 (GRCm39) splice site probably benign
R0645:Myom2 UTSW 8 15,167,698 (GRCm39) missense probably damaging 0.96
R0730:Myom2 UTSW 8 15,149,326 (GRCm39) missense probably benign 0.00
R0744:Myom2 UTSW 8 15,182,924 (GRCm39) nonsense probably null
R0836:Myom2 UTSW 8 15,182,924 (GRCm39) nonsense probably null
R1033:Myom2 UTSW 8 15,158,934 (GRCm39) missense probably benign 0.04
R1103:Myom2 UTSW 8 15,160,827 (GRCm39) missense probably benign 0.22
R1110:Myom2 UTSW 8 15,172,413 (GRCm39) missense probably benign 0.44
R1208:Myom2 UTSW 8 15,134,631 (GRCm39) missense probably damaging 1.00
R1208:Myom2 UTSW 8 15,134,631 (GRCm39) missense probably damaging 1.00
R1353:Myom2 UTSW 8 15,156,424 (GRCm39) missense probably damaging 1.00
R1530:Myom2 UTSW 8 15,172,384 (GRCm39) missense probably damaging 1.00
R1544:Myom2 UTSW 8 15,154,059 (GRCm39) splice site probably benign
R1576:Myom2 UTSW 8 15,134,556 (GRCm39) missense probably damaging 1.00
R1758:Myom2 UTSW 8 15,115,795 (GRCm39) missense probably benign 0.00
R1884:Myom2 UTSW 8 15,164,278 (GRCm39) missense probably benign 0.01
R1908:Myom2 UTSW 8 15,131,023 (GRCm39) missense probably damaging 1.00
R1962:Myom2 UTSW 8 15,182,599 (GRCm39) splice site probably null
R1977:Myom2 UTSW 8 15,135,263 (GRCm39) missense possibly damaging 0.47
R2018:Myom2 UTSW 8 15,181,151 (GRCm39) missense probably damaging 1.00
R2049:Myom2 UTSW 8 15,156,379 (GRCm39) missense probably damaging 0.97
R2155:Myom2 UTSW 8 15,134,555 (GRCm39) missense probably damaging 0.98
R2314:Myom2 UTSW 8 15,113,927 (GRCm39) missense probably damaging 0.99
R2350:Myom2 UTSW 8 15,158,835 (GRCm39) missense probably benign 0.09
R2358:Myom2 UTSW 8 15,162,018 (GRCm39) missense possibly damaging 0.68
R2904:Myom2 UTSW 8 15,148,348 (GRCm39) missense probably benign 0.00
R3418:Myom2 UTSW 8 15,135,294 (GRCm39) missense probably benign 0.01
R3606:Myom2 UTSW 8 15,119,775 (GRCm39) missense probably damaging 1.00
R3607:Myom2 UTSW 8 15,119,775 (GRCm39) missense probably damaging 1.00
R3735:Myom2 UTSW 8 15,119,676 (GRCm39) missense probably benign 0.01
R3756:Myom2 UTSW 8 15,152,650 (GRCm39) missense probably benign 0.11
R3902:Myom2 UTSW 8 15,154,165 (GRCm39) missense probably benign
R3951:Myom2 UTSW 8 15,134,556 (GRCm39) missense probably benign 0.35
R4240:Myom2 UTSW 8 15,182,895 (GRCm39) missense probably benign 0.10
R4361:Myom2 UTSW 8 15,162,018 (GRCm39) missense possibly damaging 0.68
R4581:Myom2 UTSW 8 15,156,459 (GRCm39) missense probably benign 0.02
R4736:Myom2 UTSW 8 15,131,271 (GRCm39) missense probably damaging 0.99
R5010:Myom2 UTSW 8 15,133,310 (GRCm39) missense probably damaging 0.98
R5108:Myom2 UTSW 8 15,182,667 (GRCm39) missense probably damaging 0.99
R5370:Myom2 UTSW 8 15,149,343 (GRCm39) missense probably benign 0.10
R5427:Myom2 UTSW 8 15,163,764 (GRCm39) missense probably benign 0.03
R5498:Myom2 UTSW 8 15,179,142 (GRCm39) missense probably benign 0.01
R5504:Myom2 UTSW 8 15,178,879 (GRCm39) missense probably damaging 1.00
R5567:Myom2 UTSW 8 15,152,546 (GRCm39) missense probably benign 0.01
R5745:Myom2 UTSW 8 15,172,705 (GRCm39) missense probably benign 0.01
R5844:Myom2 UTSW 8 15,181,182 (GRCm39) critical splice donor site probably null
R5854:Myom2 UTSW 8 15,158,478 (GRCm39) missense probably benign
R6141:Myom2 UTSW 8 15,113,903 (GRCm39) missense probably damaging 1.00
R6209:Myom2 UTSW 8 15,154,173 (GRCm39) missense possibly damaging 0.76
R6248:Myom2 UTSW 8 15,148,472 (GRCm39) splice site probably null
R6378:Myom2 UTSW 8 15,149,356 (GRCm39) missense probably benign 0.11
R6829:Myom2 UTSW 8 15,172,643 (GRCm39) nonsense probably null
R6913:Myom2 UTSW 8 15,115,710 (GRCm39) missense probably benign
R6957:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6958:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6960:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6961:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6962:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6999:Myom2 UTSW 8 15,134,531 (GRCm39) missense probably benign 0.22
R7148:Myom2 UTSW 8 15,134,577 (GRCm39) missense possibly damaging 0.72
R7210:Myom2 UTSW 8 15,154,114 (GRCm39) missense probably damaging 1.00
R7298:Myom2 UTSW 8 15,148,411 (GRCm39) missense probably damaging 1.00
R7463:Myom2 UTSW 8 15,167,679 (GRCm39) missense probably null 0.94
R7535:Myom2 UTSW 8 15,167,679 (GRCm39) missense probably damaging 1.00
R7573:Myom2 UTSW 8 15,172,450 (GRCm39) missense probably damaging 1.00
R7590:Myom2 UTSW 8 15,167,679 (GRCm39) missense probably damaging 1.00
R7690:Myom2 UTSW 8 15,161,717 (GRCm39) critical splice acceptor site probably null
R7794:Myom2 UTSW 8 15,133,259 (GRCm39) missense probably damaging 1.00
R7822:Myom2 UTSW 8 15,158,454 (GRCm39) missense probably benign
R7948:Myom2 UTSW 8 15,135,306 (GRCm39) missense probably benign 0.00
R8094:Myom2 UTSW 8 15,119,418 (GRCm39) missense possibly damaging 0.94
R8268:Myom2 UTSW 8 15,179,157 (GRCm39) missense probably damaging 1.00
R8292:Myom2 UTSW 8 15,182,888 (GRCm39) missense probably benign 0.01
R8514:Myom2 UTSW 8 15,175,153 (GRCm39) missense possibly damaging 0.65
R8539:Myom2 UTSW 8 15,164,254 (GRCm39) missense probably benign 0.01
R8790:Myom2 UTSW 8 15,169,242 (GRCm39) missense probably damaging 1.00
R8824:Myom2 UTSW 8 15,164,169 (GRCm39) missense possibly damaging 0.82
R8895:Myom2 UTSW 8 15,152,589 (GRCm39) nonsense probably null
R9024:Myom2 UTSW 8 15,113,936 (GRCm39) missense probably damaging 1.00
R9129:Myom2 UTSW 8 15,154,068 (GRCm39) missense probably damaging 1.00
R9224:Myom2 UTSW 8 15,178,804 (GRCm39) missense possibly damaging 0.89
R9237:Myom2 UTSW 8 15,152,591 (GRCm39) missense possibly damaging 0.85
R9321:Myom2 UTSW 8 15,172,464 (GRCm39) missense possibly damaging 0.91
R9341:Myom2 UTSW 8 15,134,633 (GRCm39) missense probably damaging 0.97
R9343:Myom2 UTSW 8 15,134,633 (GRCm39) missense probably damaging 0.97
R9375:Myom2 UTSW 8 15,149,210 (GRCm39) missense probably damaging 1.00
R9455:Myom2 UTSW 8 15,156,293 (GRCm39) missense probably benign 0.31
R9563:Myom2 UTSW 8 15,158,399 (GRCm39) nonsense probably null
R9565:Myom2 UTSW 8 15,158,399 (GRCm39) nonsense probably null
RF001:Myom2 UTSW 8 15,131,418 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGACAACAGAATGGCCATCTCC -3'
(R):5'- GCAGTGAGACGTCAACACATG -3'

Sequencing Primer
(F):5'- TCACTTGCCCATCTGTAAGGAAGG -3'
(R):5'- GACGTCAACACATGGGCCATG -3'
Posted On 2016-11-21