Incidental Mutation 'R5743:Frem3'
ID445672
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene NameFras1 related extracellular matrix protein 3
SynonymsLOC333315
MMRRC Submission 043353-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5743 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location80611080-80695356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80615778 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1567 (T1567S)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
Predicted Effect probably damaging
Transcript: ENSMUST00000039695
AA Change: T1567S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: T1567S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,797,011 T538A possibly damaging Het
Acss2 A G 2: 155,574,616 probably benign Het
Ankef1 A G 2: 136,549,709 probably null Het
Arhgap20 T A 9: 51,816,727 M80K probably benign Het
Arhgap29 T G 3: 121,981,911 L37R probably damaging Het
Baiap3 G A 17: 25,244,785 P906S probably benign Het
Caskin2 T A 11: 115,802,289 N603I possibly damaging Het
Ccdc159 A T 9: 21,929,390 E84D probably benign Het
Ccl1 T G 11: 82,176,886 S73R possibly damaging Het
Cdh7 G T 1: 110,108,845 C585F probably damaging Het
Cga T C 4: 34,904,108 probably null Het
Coq5 A C 5: 115,279,882 E57A probably benign Het
Cstf1 T A 2: 172,377,833 L288Q probably damaging Het
Ctsll3 G T 13: 60,801,001 Q47K probably benign Het
Dchs1 T A 7: 105,771,596 Q539L probably benign Het
Fam205c G A 4: 42,873,087 T68I probably damaging Het
Fbxo46 C A 7: 19,136,495 D346E probably damaging Het
Glce T A 9: 62,070,540 T21S probably damaging Het
Gm16432 G T 1: 178,122,762 silent Het
Gm19402 C T 10: 77,690,682 D26N probably damaging Het
Gm20830 A G Y: 6,916,664 Y152H probably damaging Het
Herc3 T C 6: 58,918,799 Y1011H probably benign Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Il31ra G T 13: 112,527,487 T552K possibly damaging Het
Itga2 A G 13: 114,884,506 V86A probably damaging Het
Kcnk4 A T 19: 6,928,355 N81K possibly damaging Het
Lrp2 C A 2: 69,466,877 D3247Y probably damaging Het
Maml3 G T 3: 52,104,132 F4L unknown Het
Mcpt1 A T 14: 56,018,615 H37L probably benign Het
Mpdz T C 4: 81,421,188 M1V probably null Het
Myom2 A T 8: 15,080,914 K283N possibly damaging Het
Nrxn1 C A 17: 90,643,224 R509L probably damaging Het
Ntng1 T A 3: 110,135,420 Y30F probably damaging Het
Olfr1098 C A 2: 86,923,205 G109V probably benign Het
Olfr676 A G 7: 105,036,156 probably null Het
Olfr891 C A 9: 38,180,718 C35F probably benign Het
Orc6 A T 8: 85,302,956 Q43L probably benign Het
Otogl G A 10: 107,857,001 S874L possibly damaging Het
Pcdh9 T C 14: 93,886,724 D670G probably damaging Het
Pcdhga9 A T 18: 37,738,806 I563F probably damaging Het
Plxna1 A T 6: 89,356,529 S373T probably damaging Het
Prop1 T C 11: 50,951,009 D190G probably damaging Het
Qrich1 T A 9: 108,534,115 Y280N probably damaging Het
Rasl10a T A 11: 5,059,519 D102E probably benign Het
Rgs1 T C 1: 144,245,372 Y187C probably damaging Het
Sema5b T A 16: 35,658,476 W557R probably damaging Het
Sh2b3 A T 5: 121,828,457 L198H probably damaging Het
Slc27a3 G T 3: 90,387,072 T429K probably benign Het
Slc35f1 T G 10: 53,089,450 D320E probably benign Het
Smug1 C A 15: 103,157,616 probably null Het
Ssrp1 T A 2: 85,041,168 Y311* probably null Het
Svep1 T C 4: 58,096,223 T1466A possibly damaging Het
Tmem130 A G 5: 144,750,939 S196P probably damaging Het
Trim30d A T 7: 104,472,328 C176* probably null Het
Ush2a A G 1: 188,436,962 H1100R probably benign Het
Vezt A T 10: 93,997,095 F151L probably benign Het
Zc3h3 G T 15: 75,779,531 C638* probably null Het
Zfp128 C T 7: 12,884,727 R51C probably damaging Het
Zfp141 T G 7: 42,476,431 I206L possibly damaging Het
Zfp369 G T 13: 65,295,680 K324N probably benign Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 intron probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7403:Frem3 UTSW 8 80616145 missense probably damaging 1.00
R7422:Frem3 UTSW 8 80615763 missense probably benign 0.00
R7485:Frem3 UTSW 8 80613336 missense probably damaging 1.00
R7516:Frem3 UTSW 8 80612083 missense probably damaging 0.99
R7858:Frem3 UTSW 8 80611721 nonsense probably null
R7941:Frem3 UTSW 8 80611721 nonsense probably null
RF030:Frem3 UTSW 8 80615238 small insertion probably benign
RF034:Frem3 UTSW 8 80615238 small insertion probably benign
RF042:Frem3 UTSW 8 80615238 small insertion probably benign
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Z1176:Frem3 UTSW 8 80611503 missense probably damaging 0.99
Z1176:Frem3 UTSW 8 80615431 missense probably benign 0.03
Z1177:Frem3 UTSW 8 80616129 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACTTTGAGCTTAGAGTGACTGG -3'
(R):5'- TGTGTCTCCAGGGAAGTGTC -3'

Sequencing Primer
(F):5'- TGGAGGACACCACTCTGAGTC -3'
(R):5'- TGTCTGGGAAGACATAGAAGCCTG -3'
Posted On2016-11-21