Incidental Mutation 'R5743:Ccdc159'
ID445674
Institutional Source Beutler Lab
Gene Symbol Ccdc159
Ensembl Gene ENSMUSG00000006241
Gene Namecoiled-coil domain containing 159
Synonyms2510048L02Rik
MMRRC Submission 043353-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5743 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21927471-21935872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21929390 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 84 (E84D)
Ref Sequence ENSEMBL: ENSMUSP00000150744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006403] [ENSMUST00000046831] [ENSMUST00000170304] [ENSMUST00000213698] [ENSMUST00000214569] [ENSMUST00000214734] [ENSMUST00000216710]
Predicted Effect probably benign
Transcript: ENSMUST00000006403
AA Change: E76D

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000006403
Gene: ENSMUSG00000006241
AA Change: E76D

DomainStartEndE-ValueType
low complexity region 42 52 N/A INTRINSIC
coiled coil region 152 172 N/A INTRINSIC
low complexity region 217 227 N/A INTRINSIC
coiled coil region 261 288 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000046831
SMART Domains Protein: ENSMUSP00000048832
Gene: ENSMUSG00000040883

DomainStartEndE-ValueType
Pfam:DUF4149 17 119 1.2e-27 PFAM
transmembrane domain 164 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170304
AA Change: E84D

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126474
Gene: ENSMUSG00000006241
AA Change: E84D

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
coiled coil region 160 180 N/A INTRINSIC
low complexity region 225 235 N/A INTRINSIC
coiled coil region 269 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213698
Predicted Effect probably benign
Transcript: ENSMUST00000214569
Predicted Effect probably benign
Transcript: ENSMUST00000214734
AA Change: E84D

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215650
Predicted Effect probably benign
Transcript: ENSMUST00000216710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217589
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,797,011 T538A possibly damaging Het
Acss2 A G 2: 155,574,616 probably benign Het
Ankef1 A G 2: 136,549,709 probably null Het
Arhgap20 T A 9: 51,816,727 M80K probably benign Het
Arhgap29 T G 3: 121,981,911 L37R probably damaging Het
Baiap3 G A 17: 25,244,785 P906S probably benign Het
Caskin2 T A 11: 115,802,289 N603I possibly damaging Het
Ccl1 T G 11: 82,176,886 S73R possibly damaging Het
Cdh7 G T 1: 110,108,845 C585F probably damaging Het
Cga T C 4: 34,904,108 probably null Het
Coq5 A C 5: 115,279,882 E57A probably benign Het
Cstf1 T A 2: 172,377,833 L288Q probably damaging Het
Ctsll3 G T 13: 60,801,001 Q47K probably benign Het
Dchs1 T A 7: 105,771,596 Q539L probably benign Het
Fam205c G A 4: 42,873,087 T68I probably damaging Het
Fbxo46 C A 7: 19,136,495 D346E probably damaging Het
Frem3 A T 8: 80,615,778 T1567S probably damaging Het
Glce T A 9: 62,070,540 T21S probably damaging Het
Gm16432 G T 1: 178,122,762 silent Het
Gm19402 C T 10: 77,690,682 D26N probably damaging Het
Gm20830 A G Y: 6,916,664 Y152H probably damaging Het
Herc3 T C 6: 58,918,799 Y1011H probably benign Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Il31ra G T 13: 112,527,487 T552K possibly damaging Het
Itga2 A G 13: 114,884,506 V86A probably damaging Het
Kcnk4 A T 19: 6,928,355 N81K possibly damaging Het
Lrp2 C A 2: 69,466,877 D3247Y probably damaging Het
Maml3 G T 3: 52,104,132 F4L unknown Het
Mcpt1 A T 14: 56,018,615 H37L probably benign Het
Mpdz T C 4: 81,421,188 M1V probably null Het
Myom2 A T 8: 15,080,914 K283N possibly damaging Het
Nrxn1 C A 17: 90,643,224 R509L probably damaging Het
Ntng1 T A 3: 110,135,420 Y30F probably damaging Het
Olfr1098 C A 2: 86,923,205 G109V probably benign Het
Olfr676 A G 7: 105,036,156 probably null Het
Olfr891 C A 9: 38,180,718 C35F probably benign Het
Orc6 A T 8: 85,302,956 Q43L probably benign Het
Otogl G A 10: 107,857,001 S874L possibly damaging Het
Pcdh9 T C 14: 93,886,724 D670G probably damaging Het
Pcdhga9 A T 18: 37,738,806 I563F probably damaging Het
Plxna1 A T 6: 89,356,529 S373T probably damaging Het
Prop1 T C 11: 50,951,009 D190G probably damaging Het
Qrich1 T A 9: 108,534,115 Y280N probably damaging Het
Rasl10a T A 11: 5,059,519 D102E probably benign Het
Rgs1 T C 1: 144,245,372 Y187C probably damaging Het
Sema5b T A 16: 35,658,476 W557R probably damaging Het
Sh2b3 A T 5: 121,828,457 L198H probably damaging Het
Slc27a3 G T 3: 90,387,072 T429K probably benign Het
Slc35f1 T G 10: 53,089,450 D320E probably benign Het
Smug1 C A 15: 103,157,616 probably null Het
Ssrp1 T A 2: 85,041,168 Y311* probably null Het
Svep1 T C 4: 58,096,223 T1466A possibly damaging Het
Tmem130 A G 5: 144,750,939 S196P probably damaging Het
Trim30d A T 7: 104,472,328 C176* probably null Het
Ush2a A G 1: 188,436,962 H1100R probably benign Het
Vezt A T 10: 93,997,095 F151L probably benign Het
Zc3h3 G T 15: 75,779,531 C638* probably null Het
Zfp128 C T 7: 12,884,727 R51C probably damaging Het
Zfp141 T G 7: 42,476,431 I206L possibly damaging Het
Zfp369 G T 13: 65,295,680 K324N probably benign Het
Other mutations in Ccdc159
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Ccdc159 APN 9 21929469 missense possibly damaging 0.83
IGL02322:Ccdc159 APN 9 21929373 missense possibly damaging 0.46
IGL03156:Ccdc159 APN 9 21929475 missense probably benign
IGL03382:Ccdc159 APN 9 21931696 splice site probably null
R1622:Ccdc159 UTSW 9 21929370 missense possibly damaging 0.66
R2076:Ccdc159 UTSW 9 21929506 unclassified probably null
R3905:Ccdc159 UTSW 9 21934519 critical splice donor site probably null
R4083:Ccdc159 UTSW 9 21929403 missense possibly damaging 0.83
R4625:Ccdc159 UTSW 9 21929466 missense probably benign
R4700:Ccdc159 UTSW 9 21927731 splice site probably null
R5004:Ccdc159 UTSW 9 21932945 missense probably damaging 1.00
R6245:Ccdc159 UTSW 9 21935568 missense probably damaging 0.99
R7263:Ccdc159 UTSW 9 21931711 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGAGAGCCTGGTAGACATTTG -3'
(R):5'- TTCCCTACGCGCCATAGTAG -3'

Sequencing Primer
(F):5'- CCTGGTAGACATTTGGAGGCC -3'
(R):5'- GTGCACAGCAAGTTCACTCTTAGG -3'
Posted On2016-11-21