Incidental Mutation 'R5743:Olfr891'
ID445675
Institutional Source Beutler Lab
Gene Symbol Olfr891
Ensembl Gene ENSMUSG00000045528
Gene Nameolfactory receptor 891
SynonymsGA_x6K02T2PVTD-31862167-31861217, MOR170-9
MMRRC Submission 043353-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5743 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38179871-38180821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 38180718 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 35 (C35F)
Ref Sequence ENSEMBL: ENSMUSP00000055451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062535]
Predicted Effect probably benign
Transcript: ENSMUST00000062535
AA Change: C35F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055451
Gene: ENSMUSG00000045528
AA Change: C35F

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1e-37 PFAM
Pfam:7tm_1 41 289 9.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182282
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,797,011 T538A possibly damaging Het
Acss2 A G 2: 155,574,616 probably benign Het
Ankef1 A G 2: 136,549,709 probably null Het
Arhgap20 T A 9: 51,816,727 M80K probably benign Het
Arhgap29 T G 3: 121,981,911 L37R probably damaging Het
Baiap3 G A 17: 25,244,785 P906S probably benign Het
Caskin2 T A 11: 115,802,289 N603I possibly damaging Het
Ccdc159 A T 9: 21,929,390 E84D probably benign Het
Ccl1 T G 11: 82,176,886 S73R possibly damaging Het
Cdh7 G T 1: 110,108,845 C585F probably damaging Het
Cga T C 4: 34,904,108 probably null Het
Coq5 A C 5: 115,279,882 E57A probably benign Het
Cstf1 T A 2: 172,377,833 L288Q probably damaging Het
Ctsll3 G T 13: 60,801,001 Q47K probably benign Het
Dchs1 T A 7: 105,771,596 Q539L probably benign Het
Fam205c G A 4: 42,873,087 T68I probably damaging Het
Fbxo46 C A 7: 19,136,495 D346E probably damaging Het
Frem3 A T 8: 80,615,778 T1567S probably damaging Het
Glce T A 9: 62,070,540 T21S probably damaging Het
Gm16432 G T 1: 178,122,762 silent Het
Gm19402 C T 10: 77,690,682 D26N probably damaging Het
Gm20830 A G Y: 6,916,664 Y152H probably damaging Het
Herc3 T C 6: 58,918,799 Y1011H probably benign Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Il31ra G T 13: 112,527,487 T552K possibly damaging Het
Itga2 A G 13: 114,884,506 V86A probably damaging Het
Kcnk4 A T 19: 6,928,355 N81K possibly damaging Het
Lrp2 C A 2: 69,466,877 D3247Y probably damaging Het
Maml3 G T 3: 52,104,132 F4L unknown Het
Mcpt1 A T 14: 56,018,615 H37L probably benign Het
Mpdz T C 4: 81,421,188 M1V probably null Het
Myom2 A T 8: 15,080,914 K283N possibly damaging Het
Nrxn1 C A 17: 90,643,224 R509L probably damaging Het
Ntng1 T A 3: 110,135,420 Y30F probably damaging Het
Olfr1098 C A 2: 86,923,205 G109V probably benign Het
Olfr676 A G 7: 105,036,156 probably null Het
Orc6 A T 8: 85,302,956 Q43L probably benign Het
Otogl G A 10: 107,857,001 S874L possibly damaging Het
Pcdh9 T C 14: 93,886,724 D670G probably damaging Het
Pcdhga9 A T 18: 37,738,806 I563F probably damaging Het
Plxna1 A T 6: 89,356,529 S373T probably damaging Het
Prop1 T C 11: 50,951,009 D190G probably damaging Het
Qrich1 T A 9: 108,534,115 Y280N probably damaging Het
Rasl10a T A 11: 5,059,519 D102E probably benign Het
Rgs1 T C 1: 144,245,372 Y187C probably damaging Het
Sema5b T A 16: 35,658,476 W557R probably damaging Het
Sh2b3 A T 5: 121,828,457 L198H probably damaging Het
Slc27a3 G T 3: 90,387,072 T429K probably benign Het
Slc35f1 T G 10: 53,089,450 D320E probably benign Het
Smug1 C A 15: 103,157,616 probably null Het
Ssrp1 T A 2: 85,041,168 Y311* probably null Het
Svep1 T C 4: 58,096,223 T1466A possibly damaging Het
Tmem130 A G 5: 144,750,939 S196P probably damaging Het
Trim30d A T 7: 104,472,328 C176* probably null Het
Ush2a A G 1: 188,436,962 H1100R probably benign Het
Vezt A T 10: 93,997,095 F151L probably benign Het
Zc3h3 G T 15: 75,779,531 C638* probably null Het
Zfp128 C T 7: 12,884,727 R51C probably damaging Het
Zfp141 T G 7: 42,476,431 I206L possibly damaging Het
Zfp369 G T 13: 65,295,680 K324N probably benign Het
Other mutations in Olfr891
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02821:Olfr891 APN 9 38180668 missense possibly damaging 0.65
IGL02987:Olfr891 APN 9 38180623 missense possibly damaging 0.89
R0032:Olfr891 UTSW 9 38180608 missense probably damaging 1.00
R1604:Olfr891 UTSW 9 38180349 missense probably benign 0.12
R1678:Olfr891 UTSW 9 38180637 missense possibly damaging 0.65
R2230:Olfr891 UTSW 9 38180146 missense probably benign 0.00
R4391:Olfr891 UTSW 9 38180349 missense probably damaging 0.99
R4470:Olfr891 UTSW 9 38180370 missense probably damaging 0.96
R4803:Olfr891 UTSW 9 38180250 missense probably damaging 1.00
R4865:Olfr891 UTSW 9 38179900 missense possibly damaging 0.53
R5652:Olfr891 UTSW 9 38180815 missense probably benign 0.01
R7088:Olfr891 UTSW 9 38180452 missense probably damaging 1.00
R7097:Olfr891 UTSW 9 38180336 nonsense probably null
R7214:Olfr891 UTSW 9 38180022 missense probably damaging 1.00
R7631:Olfr891 UTSW 9 38180706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCTGTGTCATGCATCC -3'
(R):5'- TGAGCCATCTCTCTAGCACC -3'

Sequencing Primer
(F):5'- AGTGTTTTGGGAGTAAAGGC -3'
(R):5'- GTCCTTTTTAAATCACTGACAGAGTC -3'
Posted On2016-11-21