Incidental Mutation 'R5743:Arhgap20'
ID445676
Institutional Source Beutler Lab
Gene Symbol Arhgap20
Ensembl Gene ENSMUSG00000053199
Gene NameRho GTPase activating protein 20
Synonyms6530403F17Rik, A530023E23Rik
MMRRC Submission 043353-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R5743 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location51765337-51853856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51816727 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 80 (M80K)
Ref Sequence ENSEMBL: ENSMUSP00000065633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065496] [ENSMUST00000130405]
Predicted Effect probably benign
Transcript: ENSMUST00000065496
AA Change: M80K

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000065633
Gene: ENSMUSG00000053199
AA Change: M80K

DomainStartEndE-ValueType
PH 86 187 3.31e-5 SMART
Pfam:RA 194 283 3.6e-15 PFAM
RhoGAP 374 548 1.27e-41 SMART
internal_repeat_1 655 779 9.97e-15 PROSPERO
internal_repeat_1 797 922 9.97e-15 PROSPERO
low complexity region 935 962 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126567
Predicted Effect probably benign
Transcript: ENSMUST00000130405
AA Change: M44K

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000120124
Gene: ENSMUSG00000053199
AA Change: M44K

DomainStartEndE-ValueType
PH 50 151 3.31e-5 SMART
Pfam:RA 158 247 3.3e-14 PFAM
RhoGAP 338 512 1.27e-41 SMART
internal_repeat_1 619 743 7.07e-15 PROSPERO
internal_repeat_1 761 886 7.07e-15 PROSPERO
low complexity region 899 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146509
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an activator of RHO-type GTPases, transducing a signal from RAP1 to RHO and impacting neurite outgrowth. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,797,011 T538A possibly damaging Het
Acss2 A G 2: 155,574,616 probably benign Het
Ankef1 A G 2: 136,549,709 probably null Het
Arhgap29 T G 3: 121,981,911 L37R probably damaging Het
Baiap3 G A 17: 25,244,785 P906S probably benign Het
Caskin2 T A 11: 115,802,289 N603I possibly damaging Het
Ccdc159 A T 9: 21,929,390 E84D probably benign Het
Ccl1 T G 11: 82,176,886 S73R possibly damaging Het
Cdh7 G T 1: 110,108,845 C585F probably damaging Het
Cga T C 4: 34,904,108 probably null Het
Coq5 A C 5: 115,279,882 E57A probably benign Het
Cstf1 T A 2: 172,377,833 L288Q probably damaging Het
Ctsll3 G T 13: 60,801,001 Q47K probably benign Het
Dchs1 T A 7: 105,771,596 Q539L probably benign Het
Fam205c G A 4: 42,873,087 T68I probably damaging Het
Fbxo46 C A 7: 19,136,495 D346E probably damaging Het
Frem3 A T 8: 80,615,778 T1567S probably damaging Het
Glce T A 9: 62,070,540 T21S probably damaging Het
Gm16432 G T 1: 178,122,762 silent Het
Gm19402 C T 10: 77,690,682 D26N probably damaging Het
Gm20830 A G Y: 6,916,664 Y152H probably damaging Het
Herc3 T C 6: 58,918,799 Y1011H probably benign Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Il31ra G T 13: 112,527,487 T552K possibly damaging Het
Itga2 A G 13: 114,884,506 V86A probably damaging Het
Kcnk4 A T 19: 6,928,355 N81K possibly damaging Het
Lrp2 C A 2: 69,466,877 D3247Y probably damaging Het
Maml3 G T 3: 52,104,132 F4L unknown Het
Mcpt1 A T 14: 56,018,615 H37L probably benign Het
Mpdz T C 4: 81,421,188 M1V probably null Het
Myom2 A T 8: 15,080,914 K283N possibly damaging Het
Nrxn1 C A 17: 90,643,224 R509L probably damaging Het
Ntng1 T A 3: 110,135,420 Y30F probably damaging Het
Olfr1098 C A 2: 86,923,205 G109V probably benign Het
Olfr676 A G 7: 105,036,156 probably null Het
Olfr891 C A 9: 38,180,718 C35F probably benign Het
Orc6 A T 8: 85,302,956 Q43L probably benign Het
Otogl G A 10: 107,857,001 S874L possibly damaging Het
Pcdh9 T C 14: 93,886,724 D670G probably damaging Het
Pcdhga9 A T 18: 37,738,806 I563F probably damaging Het
Plxna1 A T 6: 89,356,529 S373T probably damaging Het
Prop1 T C 11: 50,951,009 D190G probably damaging Het
Qrich1 T A 9: 108,534,115 Y280N probably damaging Het
Rasl10a T A 11: 5,059,519 D102E probably benign Het
Rgs1 T C 1: 144,245,372 Y187C probably damaging Het
Sema5b T A 16: 35,658,476 W557R probably damaging Het
Sh2b3 A T 5: 121,828,457 L198H probably damaging Het
Slc27a3 G T 3: 90,387,072 T429K probably benign Het
Slc35f1 T G 10: 53,089,450 D320E probably benign Het
Smug1 C A 15: 103,157,616 probably null Het
Ssrp1 T A 2: 85,041,168 Y311* probably null Het
Svep1 T C 4: 58,096,223 T1466A possibly damaging Het
Tmem130 A G 5: 144,750,939 S196P probably damaging Het
Trim30d A T 7: 104,472,328 C176* probably null Het
Ush2a A G 1: 188,436,962 H1100R probably benign Het
Vezt A T 10: 93,997,095 F151L probably benign Het
Zc3h3 G T 15: 75,779,531 C638* probably null Het
Zfp128 C T 7: 12,884,727 R51C probably damaging Het
Zfp141 T G 7: 42,476,431 I206L possibly damaging Het
Zfp369 G T 13: 65,295,680 K324N probably benign Het
Other mutations in Arhgap20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Arhgap20 APN 9 51849413 missense probably benign 0.00
IGL01542:Arhgap20 APN 9 51838887 missense probably benign
IGL01815:Arhgap20 APN 9 51846168 missense probably damaging 1.00
IGL01975:Arhgap20 APN 9 51849797 nonsense probably null
IGL02041:Arhgap20 APN 9 51846190 missense possibly damaging 0.92
IGL02557:Arhgap20 APN 9 51821273 missense probably damaging 1.00
IGL02602:Arhgap20 APN 9 51825843 missense probably damaging 1.00
IGL02741:Arhgap20 APN 9 51848645 missense probably benign 0.17
IGL02792:Arhgap20 APN 9 51849918 missense possibly damaging 0.89
IGL03166:Arhgap20 APN 9 51849777 missense possibly damaging 0.63
P0047:Arhgap20 UTSW 9 51849236 missense probably damaging 1.00
R0115:Arhgap20 UTSW 9 51838972 missense probably damaging 1.00
R0121:Arhgap20 UTSW 9 51838951 missense possibly damaging 0.91
R0539:Arhgap20 UTSW 9 51850155 missense probably benign 0.01
R0541:Arhgap20 UTSW 9 51849663 missense probably damaging 1.00
R0551:Arhgap20 UTSW 9 51825825 splice site probably benign
R0570:Arhgap20 UTSW 9 51840451 missense possibly damaging 0.56
R0630:Arhgap20 UTSW 9 51849384 missense probably damaging 0.98
R0931:Arhgap20 UTSW 9 51816741 missense probably benign 0.30
R0992:Arhgap20 UTSW 9 51816786 missense probably damaging 0.96
R1052:Arhgap20 UTSW 9 51846270 missense probably damaging 0.98
R1779:Arhgap20 UTSW 9 51849915 missense probably benign
R1839:Arhgap20 UTSW 9 51849326 missense probably damaging 0.99
R1942:Arhgap20 UTSW 9 51831698 missense probably benign 0.43
R2292:Arhgap20 UTSW 9 51849443 missense possibly damaging 0.63
R3896:Arhgap20 UTSW 9 51816837 missense probably damaging 0.96
R4109:Arhgap20 UTSW 9 51816685 missense possibly damaging 0.60
R4166:Arhgap20 UTSW 9 51826835 critical splice acceptor site probably null
R4631:Arhgap20 UTSW 9 51840353 intron probably benign
R4692:Arhgap20 UTSW 9 51785788 missense probably damaging 1.00
R5273:Arhgap20 UTSW 9 51848616 missense probably damaging 1.00
R5505:Arhgap20 UTSW 9 51838948 missense probably damaging 0.98
R5847:Arhgap20 UTSW 9 51824976 intron probably benign
R6006:Arhgap20 UTSW 9 51850126 missense probably benign
R6112:Arhgap20 UTSW 9 51829384 missense probably damaging 1.00
R6355:Arhgap20 UTSW 9 51843720 missense probably damaging 1.00
R6576:Arhgap20 UTSW 9 51849278 missense probably benign 0.03
R6801:Arhgap20 UTSW 9 51848592 missense probably damaging 1.00
R7130:Arhgap20 UTSW 9 51849747 missense probably damaging 0.98
R7318:Arhgap20 UTSW 9 51840502 missense probably benign
R7347:Arhgap20 UTSW 9 51849035 missense probably benign 0.07
R7500:Arhgap20 UTSW 9 51840502 missense probably benign
R7598:Arhgap20 UTSW 9 51849790 missense possibly damaging 0.95
R7677:Arhgap20 UTSW 9 51840398 missense probably damaging 0.97
R7725:Arhgap20 UTSW 9 51831750 missense possibly damaging 0.80
R8086:Arhgap20 UTSW 9 51849263 missense probably benign 0.00
R8122:Arhgap20 UTSW 9 51849993 missense probably damaging 0.99
R8125:Arhgap20 UTSW 9 51826909 missense probably damaging 0.99
R8196:Arhgap20 UTSW 9 51848977 missense possibly damaging 0.94
Z1177:Arhgap20 UTSW 9 51824924 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCGCTGCTTTAAGGAAACAG -3'
(R):5'- ATACTAGGCCCTTGATGGAGGC -3'

Sequencing Primer
(F):5'- CCGCTGCTTTAAGGAAACAGAAAAAG -3'
(R):5'- CCAAGTAGAGAATGTGGTCTCC -3'
Posted On2016-11-21