Incidental Mutation 'R5743:Caskin2'
ID445687
Institutional Source Beutler Lab
Gene Symbol Caskin2
Ensembl Gene ENSMUSG00000034471
Gene NameCASK-interacting protein 2
Synonyms1600028L06Rik
MMRRC Submission 043353-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R5743 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115799183-115813639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115802289 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 603 (N603I)
Ref Sequence ENSEMBL: ENSMUSP00000041328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041684] [ENSMUST00000093912] [ENSMUST00000103033] [ENSMUST00000132780] [ENSMUST00000156812]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041684
AA Change: N603I

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000041328
Gene: ENSMUSG00000034471
AA Change: N603I

DomainStartEndE-ValueType
ANK 2 32 1.27e3 SMART
ANK 48 77 3.01e-4 SMART
ANK 81 110 3.41e-3 SMART
ANK 114 143 1.4e-4 SMART
ANK 147 176 3.26e0 SMART
ANK 188 217 3.33e-6 SMART
ANK 220 249 4.82e-3 SMART
SH3 284 346 1.13e-6 SMART
SAM 485 551 8.53e-12 SMART
SAM 554 621 1.41e-12 SMART
low complexity region 762 774 N/A INTRINSIC
Pfam:Caskin-Pro-rich 793 883 1.4e-32 PFAM
low complexity region 904 921 N/A INTRINSIC
low complexity region 925 944 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1042 1069 N/A INTRINSIC
low complexity region 1084 1090 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
Pfam:Caskin-tail 1144 1201 4.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093912
SMART Domains Protein: ENSMUSP00000091440
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
SCOP:d1eula_ 979 1282 6e-10 SMART
transmembrane domain 1310 1332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103033
SMART Domains Protein: ENSMUSP00000099322
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
low complexity region 1096 1109 N/A INTRINSIC
Pfam:Cation_ATPase_C 1120 1334 5.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125658
Predicted Effect probably benign
Transcript: ENSMUST00000132780
SMART Domains Protein: ENSMUSP00000119158
Gene: ENSMUSG00000034471

DomainStartEndE-ValueType
ANK 27 56 3.01e-4 SMART
ANK 60 89 3.41e-3 SMART
ANK 93 122 1.4e-4 SMART
ANK 126 155 3.26e0 SMART
ANK 167 196 3.33e-6 SMART
ANK 199 228 4.82e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156812
SMART Domains Protein: ENSMUSP00000114310
Gene: ENSMUSG00000034471

DomainStartEndE-ValueType
ANK 2 32 1.27e3 SMART
ANK 48 77 3.01e-4 SMART
ANK 81 110 3.41e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that contains six ankyrin repeats, as well as a Src homology 3 (SH3) domain and two sterile alpha motif (SAM) domains, which may be involved in protein-protein interactions. The C-terminal portion of this protein is proline-rich and contains a conserved region. A related protein interacts with calcium/calmodulin-dependent serine protein kinase (CASK). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,797,011 T538A possibly damaging Het
Acss2 A G 2: 155,574,616 probably benign Het
Ankef1 A G 2: 136,549,709 probably null Het
Arhgap20 T A 9: 51,816,727 M80K probably benign Het
Arhgap29 T G 3: 121,981,911 L37R probably damaging Het
Baiap3 G A 17: 25,244,785 P906S probably benign Het
Ccdc159 A T 9: 21,929,390 E84D probably benign Het
Ccl1 T G 11: 82,176,886 S73R possibly damaging Het
Cdh7 G T 1: 110,108,845 C585F probably damaging Het
Cga T C 4: 34,904,108 probably null Het
Coq5 A C 5: 115,279,882 E57A probably benign Het
Cstf1 T A 2: 172,377,833 L288Q probably damaging Het
Ctsll3 G T 13: 60,801,001 Q47K probably benign Het
Dchs1 T A 7: 105,771,596 Q539L probably benign Het
Fam205c G A 4: 42,873,087 T68I probably damaging Het
Fbxo46 C A 7: 19,136,495 D346E probably damaging Het
Frem3 A T 8: 80,615,778 T1567S probably damaging Het
Glce T A 9: 62,070,540 T21S probably damaging Het
Gm16432 G T 1: 178,122,762 silent Het
Gm19402 C T 10: 77,690,682 D26N probably damaging Het
Gm20830 A G Y: 6,916,664 Y152H probably damaging Het
Herc3 T C 6: 58,918,799 Y1011H probably benign Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Il31ra G T 13: 112,527,487 T552K possibly damaging Het
Itga2 A G 13: 114,884,506 V86A probably damaging Het
Kcnk4 A T 19: 6,928,355 N81K possibly damaging Het
Lrp2 C A 2: 69,466,877 D3247Y probably damaging Het
Maml3 G T 3: 52,104,132 F4L unknown Het
Mcpt1 A T 14: 56,018,615 H37L probably benign Het
Mpdz T C 4: 81,421,188 M1V probably null Het
Myom2 A T 8: 15,080,914 K283N possibly damaging Het
Nrxn1 C A 17: 90,643,224 R509L probably damaging Het
Ntng1 T A 3: 110,135,420 Y30F probably damaging Het
Olfr1098 C A 2: 86,923,205 G109V probably benign Het
Olfr676 A G 7: 105,036,156 probably null Het
Olfr891 C A 9: 38,180,718 C35F probably benign Het
Orc6 A T 8: 85,302,956 Q43L probably benign Het
Otogl G A 10: 107,857,001 S874L possibly damaging Het
Pcdh9 T C 14: 93,886,724 D670G probably damaging Het
Pcdhga9 A T 18: 37,738,806 I563F probably damaging Het
Plxna1 A T 6: 89,356,529 S373T probably damaging Het
Prop1 T C 11: 50,951,009 D190G probably damaging Het
Qrich1 T A 9: 108,534,115 Y280N probably damaging Het
Rasl10a T A 11: 5,059,519 D102E probably benign Het
Rgs1 T C 1: 144,245,372 Y187C probably damaging Het
Sema5b T A 16: 35,658,476 W557R probably damaging Het
Sh2b3 A T 5: 121,828,457 L198H probably damaging Het
Slc27a3 G T 3: 90,387,072 T429K probably benign Het
Slc35f1 T G 10: 53,089,450 D320E probably benign Het
Smug1 C A 15: 103,157,616 probably null Het
Ssrp1 T A 2: 85,041,168 Y311* probably null Het
Svep1 T C 4: 58,096,223 T1466A possibly damaging Het
Tmem130 A G 5: 144,750,939 S196P probably damaging Het
Trim30d A T 7: 104,472,328 C176* probably null Het
Ush2a A G 1: 188,436,962 H1100R probably benign Het
Vezt A T 10: 93,997,095 F151L probably benign Het
Zc3h3 G T 15: 75,779,531 C638* probably null Het
Zfp128 C T 7: 12,884,727 R51C probably damaging Het
Zfp141 T G 7: 42,476,431 I206L possibly damaging Het
Zfp369 G T 13: 65,295,680 K324N probably benign Het
Other mutations in Caskin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Caskin2 APN 11 115803599 missense probably benign 0.00
IGL01936:Caskin2 APN 11 115804717 missense probably damaging 0.99
IGL02322:Caskin2 APN 11 115804477 missense probably damaging 0.99
R0119:Caskin2 UTSW 11 115802427 unclassified probably benign
R0127:Caskin2 UTSW 11 115800994 missense probably damaging 1.00
R0565:Caskin2 UTSW 11 115801016 missense probably damaging 1.00
R0741:Caskin2 UTSW 11 115804800 missense probably damaging 1.00
R1332:Caskin2 UTSW 11 115803345 unclassified probably benign
R1474:Caskin2 UTSW 11 115803696 missense probably benign 0.05
R1720:Caskin2 UTSW 11 115802782 missense probably damaging 1.00
R1968:Caskin2 UTSW 11 115803614 missense probably benign 0.00
R2054:Caskin2 UTSW 11 115806301 unclassified probably benign
R2061:Caskin2 UTSW 11 115803630 missense probably benign
R2893:Caskin2 UTSW 11 115801277 missense probably benign 0.00
R3036:Caskin2 UTSW 11 115806356 missense probably damaging 1.00
R3123:Caskin2 UTSW 11 115804797 missense probably damaging 1.00
R3124:Caskin2 UTSW 11 115804797 missense probably damaging 1.00
R4822:Caskin2 UTSW 11 115807299 missense probably damaging 1.00
R5095:Caskin2 UTSW 11 115800738 missense probably benign
R5654:Caskin2 UTSW 11 115800079 critical splice acceptor site probably null
R5801:Caskin2 UTSW 11 115803473 missense probably damaging 1.00
R5808:Caskin2 UTSW 11 115801763 missense probably damaging 1.00
R6259:Caskin2 UTSW 11 115800453 missense probably damaging 1.00
R6618:Caskin2 UTSW 11 115800029 missense possibly damaging 0.89
R7142:Caskin2 UTSW 11 115806736 missense probably benign 0.29
R7192:Caskin2 UTSW 11 115801376 missense probably damaging 1.00
R7247:Caskin2 UTSW 11 115801896 missense probably benign
R7290:Caskin2 UTSW 11 115804789 missense possibly damaging 0.63
R7451:Caskin2 UTSW 11 115812155 start gained probably benign
X0063:Caskin2 UTSW 11 115806412 missense probably damaging 1.00
Z1176:Caskin2 UTSW 11 115802096 missense probably damaging 1.00
Z1176:Caskin2 UTSW 11 115802103 missense probably damaging 1.00
Z1176:Caskin2 UTSW 11 115803620 missense probably benign 0.04
Z1177:Caskin2 UTSW 11 115806781 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCATTAGCTTCTTCTGGTGC -3'
(R):5'- GCCCAATTATATCCCGGTGAG -3'

Sequencing Primer
(F):5'- CTTCTGGTGCCCTGGAAG -3'
(R):5'- CAATTATATCCCGGTGAGCAGGTG -3'
Posted On2016-11-21