Incidental Mutation 'R5743:Il31ra'
ID445690
Institutional Source Beutler Lab
Gene Symbol Il31ra
Ensembl Gene ENSMUSG00000050377
Gene Nameinterleukin 31 receptor A
SynonymsGLM-R, GPL
MMRRC Submission 043353-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5743 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location112519898-112594360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 112527487 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 552 (T552K)
Ref Sequence ENSEMBL: ENSMUSP00000152979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051756] [ENSMUST00000223752] [ENSMUST00000223819] [ENSMUST00000224510] [ENSMUST00000224576]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051756
AA Change: T525K

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058045
Gene: ENSMUSG00000050377
AA Change: T525K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FN3 115 198 7.75e0 SMART
Blast:FN3 216 297 1e-40 BLAST
FN3 325 394 1.15e1 SMART
FN3 408 490 7.18e-3 SMART
low complexity region 508 522 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223577
Predicted Effect probably benign
Transcript: ENSMUST00000223752
Predicted Effect possibly damaging
Transcript: ENSMUST00000223819
AA Change: T552K

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224070
Predicted Effect possibly damaging
Transcript: ENSMUST00000224510
AA Change: T444K

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000224576
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the type I cytokine receptor family. This receptor, with homology to gp130, is expressed on monocytes, and is involved in IL-31 signaling via activation of STAT-3 and STAT-5. It functions either as a monomer, or as part of a receptor complex with oncostatin M receptor (OSMR). Several alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous null mice display no apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,797,011 T538A possibly damaging Het
Acss2 A G 2: 155,574,616 probably benign Het
Ankef1 A G 2: 136,549,709 probably null Het
Arhgap20 T A 9: 51,816,727 M80K probably benign Het
Arhgap29 T G 3: 121,981,911 L37R probably damaging Het
Baiap3 G A 17: 25,244,785 P906S probably benign Het
Caskin2 T A 11: 115,802,289 N603I possibly damaging Het
Ccdc159 A T 9: 21,929,390 E84D probably benign Het
Ccl1 T G 11: 82,176,886 S73R possibly damaging Het
Cdh7 G T 1: 110,108,845 C585F probably damaging Het
Cga T C 4: 34,904,108 probably null Het
Coq5 A C 5: 115,279,882 E57A probably benign Het
Cstf1 T A 2: 172,377,833 L288Q probably damaging Het
Ctsll3 G T 13: 60,801,001 Q47K probably benign Het
Dchs1 T A 7: 105,771,596 Q539L probably benign Het
Fam205c G A 4: 42,873,087 T68I probably damaging Het
Fbxo46 C A 7: 19,136,495 D346E probably damaging Het
Frem3 A T 8: 80,615,778 T1567S probably damaging Het
Glce T A 9: 62,070,540 T21S probably damaging Het
Gm16432 G T 1: 178,122,762 silent Het
Gm19402 C T 10: 77,690,682 D26N probably damaging Het
Gm20830 A G Y: 6,916,664 Y152H probably damaging Het
Herc3 T C 6: 58,918,799 Y1011H probably benign Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Itga2 A G 13: 114,884,506 V86A probably damaging Het
Kcnk4 A T 19: 6,928,355 N81K possibly damaging Het
Lrp2 C A 2: 69,466,877 D3247Y probably damaging Het
Maml3 G T 3: 52,104,132 F4L unknown Het
Mcpt1 A T 14: 56,018,615 H37L probably benign Het
Mpdz T C 4: 81,421,188 M1V probably null Het
Myom2 A T 8: 15,080,914 K283N possibly damaging Het
Nrxn1 C A 17: 90,643,224 R509L probably damaging Het
Ntng1 T A 3: 110,135,420 Y30F probably damaging Het
Olfr1098 C A 2: 86,923,205 G109V probably benign Het
Olfr676 A G 7: 105,036,156 probably null Het
Olfr891 C A 9: 38,180,718 C35F probably benign Het
Orc6 A T 8: 85,302,956 Q43L probably benign Het
Otogl G A 10: 107,857,001 S874L possibly damaging Het
Pcdh9 T C 14: 93,886,724 D670G probably damaging Het
Pcdhga9 A T 18: 37,738,806 I563F probably damaging Het
Plxna1 A T 6: 89,356,529 S373T probably damaging Het
Prop1 T C 11: 50,951,009 D190G probably damaging Het
Qrich1 T A 9: 108,534,115 Y280N probably damaging Het
Rasl10a T A 11: 5,059,519 D102E probably benign Het
Rgs1 T C 1: 144,245,372 Y187C probably damaging Het
Sema5b T A 16: 35,658,476 W557R probably damaging Het
Sh2b3 A T 5: 121,828,457 L198H probably damaging Het
Slc27a3 G T 3: 90,387,072 T429K probably benign Het
Slc35f1 T G 10: 53,089,450 D320E probably benign Het
Smug1 C A 15: 103,157,616 probably null Het
Ssrp1 T A 2: 85,041,168 Y311* probably null Het
Svep1 T C 4: 58,096,223 T1466A possibly damaging Het
Tmem130 A G 5: 144,750,939 S196P probably damaging Het
Trim30d A T 7: 104,472,328 C176* probably null Het
Ush2a A G 1: 188,436,962 H1100R probably benign Het
Vezt A T 10: 93,997,095 F151L probably benign Het
Zc3h3 G T 15: 75,779,531 C638* probably null Het
Zfp128 C T 7: 12,884,727 R51C probably damaging Het
Zfp141 T G 7: 42,476,431 I206L possibly damaging Het
Zfp369 G T 13: 65,295,680 K324N probably benign Het
Other mutations in Il31ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Il31ra APN 13 112547478 missense possibly damaging 0.94
IGL00639:Il31ra APN 13 112549559 nonsense probably null
IGL01640:Il31ra APN 13 112531758 missense possibly damaging 0.58
IGL02009:Il31ra APN 13 112533867 missense probably damaging 0.98
IGL02431:Il31ra APN 13 112530296 missense probably damaging 1.00
IGL02675:Il31ra APN 13 112524352 missense probably benign 0.00
IGL02718:Il31ra APN 13 112530369 nonsense probably null
IGL03388:Il31ra APN 13 112546212 missense probably damaging 1.00
IGL03408:Il31ra APN 13 112525888 missense probably benign 0.21
R0482:Il31ra UTSW 13 112527481 missense possibly damaging 0.89
R0639:Il31ra UTSW 13 112525843 missense possibly damaging 0.95
R0905:Il31ra UTSW 13 112531673 missense probably damaging 1.00
R0948:Il31ra UTSW 13 112530378 missense possibly damaging 0.81
R1420:Il31ra UTSW 13 112531752 missense probably damaging 1.00
R1538:Il31ra UTSW 13 112547466 missense possibly damaging 0.91
R1776:Il31ra UTSW 13 112541239 missense probably damaging 0.97
R1931:Il31ra UTSW 13 112541222 missense probably damaging 1.00
R2006:Il31ra UTSW 13 112530356 missense probably damaging 1.00
R2134:Il31ra UTSW 13 112543888 missense possibly damaging 0.94
R3103:Il31ra UTSW 13 112530351 missense probably damaging 1.00
R4089:Il31ra UTSW 13 112551919 nonsense probably null
R4742:Il31ra UTSW 13 112523967 nonsense probably null
R4787:Il31ra UTSW 13 112527545 missense possibly damaging 0.82
R5154:Il31ra UTSW 13 112523997 missense possibly damaging 0.87
R5193:Il31ra UTSW 13 112524330 missense probably benign 0.34
R5402:Il31ra UTSW 13 112524135 missense probably benign 0.01
R5917:Il31ra UTSW 13 112546312 missense probably benign
R6126:Il31ra UTSW 13 112530374 missense probably damaging 1.00
R6414:Il31ra UTSW 13 112523907 missense possibly damaging 0.90
R6580:Il31ra UTSW 13 112551942 missense possibly damaging 0.90
R6727:Il31ra UTSW 13 112547368 missense probably damaging 1.00
R6783:Il31ra UTSW 13 112551988 critical splice acceptor site probably null
R6912:Il31ra UTSW 13 112549464 missense probably damaging 0.99
R6925:Il31ra UTSW 13 112527529 missense possibly damaging 0.56
R7187:Il31ra UTSW 13 112546311 missense probably benign 0.04
R7210:Il31ra UTSW 13 112549500 missense possibly damaging 0.95
R7236:Il31ra UTSW 13 112523905 makesense probably null
R7323:Il31ra UTSW 13 112551963 missense probably damaging 1.00
R7618:Il31ra UTSW 13 112551980 missense possibly damaging 0.66
R7783:Il31ra UTSW 13 112541251 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGTATGGCCTTTAATCCTTC -3'
(R):5'- GCTAGATAGGGAGCCAAAACCC -3'

Sequencing Primer
(F):5'- CCTTCTCACACATATGGATCAAATG -3'
(R):5'- TAGGGAGCCAAAACCCCAGTG -3'
Posted On2016-11-21