Incidental Mutation 'R5743:Mcpt1'
ID 445692
Institutional Source Beutler Lab
Gene Symbol Mcpt1
Ensembl Gene ENSMUSG00000022227
Gene Name mast cell protease 1
Synonyms Mcp-1
MMRRC Submission 043353-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R5743 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 56255428-56257841 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 56256072 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 37 (H37L)
Ref Sequence ENSEMBL: ENSMUSP00000022836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022836]
AlphaFold P11034
Predicted Effect probably benign
Transcript: ENSMUST00000022836
AA Change: H37L

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022836
Gene: ENSMUSG00000022227
AA Change: H37L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Tryp_SPc 20 239 1.01e-84 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display an increased succeptibility to parasitic infections which cause increased numbers of intestinal mucosal mast cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,416,536 (GRCm39) probably benign Het
Ankef1 A G 2: 136,391,629 (GRCm39) probably null Het
Arhgap20 T A 9: 51,728,027 (GRCm39) M80K probably benign Het
Arhgap29 T G 3: 121,775,560 (GRCm39) L37R probably damaging Het
Baiap3 G A 17: 25,463,759 (GRCm39) P906S probably benign Het
Caskin2 T A 11: 115,693,115 (GRCm39) N603I possibly damaging Het
Catspere2 G T 1: 177,950,328 (GRCm39) silent Het
Ccdc159 A T 9: 21,840,686 (GRCm39) E84D probably benign Het
Ccl1 T G 11: 82,067,712 (GRCm39) S73R possibly damaging Het
Cdh20 G T 1: 110,036,575 (GRCm39) C585F probably damaging Het
Cga T C 4: 34,904,108 (GRCm39) probably null Het
Coq5 A C 5: 115,417,941 (GRCm39) E57A probably benign Het
Cstf1 T A 2: 172,219,753 (GRCm39) L288Q probably damaging Het
Ctsll3 G T 13: 60,948,815 (GRCm39) Q47K probably benign Het
Dchs1 T A 7: 105,420,803 (GRCm39) Q539L probably benign Het
Fbxo46 C A 7: 18,870,420 (GRCm39) D346E probably damaging Het
Frem3 A T 8: 81,342,407 (GRCm39) T1567S probably damaging Het
Glce T A 9: 61,977,822 (GRCm39) T21S probably damaging Het
Gm19402 C T 10: 77,526,516 (GRCm39) D26N probably damaging Het
Gm20830 A G Y: 6,916,664 (GRCm39) Y152H probably damaging Het
Herc3 T C 6: 58,895,784 (GRCm39) Y1011H probably benign Het
Igkv6-29 C A 6: 70,115,584 (GRCm39) G70V possibly damaging Het
Il31ra G T 13: 112,664,021 (GRCm39) T552K possibly damaging Het
Itga2 A G 13: 115,021,042 (GRCm39) V86A probably damaging Het
Kcnk4 A T 19: 6,905,723 (GRCm39) N81K possibly damaging Het
Lrp2 C A 2: 69,297,221 (GRCm39) D3247Y probably damaging Het
Maml3 G T 3: 52,011,553 (GRCm39) F4L unknown Het
Mpdz T C 4: 81,339,425 (GRCm39) M1V probably null Het
Myom2 A T 8: 15,130,914 (GRCm39) K283N possibly damaging Het
Nrxn1 C A 17: 90,950,652 (GRCm39) R509L probably damaging Het
Ntng1 T A 3: 110,042,736 (GRCm39) Y30F probably damaging Het
Or52e7 A G 7: 104,685,363 (GRCm39) probably null Het
Or8c13 C A 9: 38,092,014 (GRCm39) C35F probably benign Het
Or8h8 C A 2: 86,753,549 (GRCm39) G109V probably benign Het
Orc6 A T 8: 86,029,585 (GRCm39) Q43L probably benign Het
Otogl G A 10: 107,692,862 (GRCm39) S874L possibly damaging Het
Pcdh9 T C 14: 94,124,160 (GRCm39) D670G probably damaging Het
Pcdhga9 A T 18: 37,871,859 (GRCm39) I563F probably damaging Het
Plxna1 A T 6: 89,333,511 (GRCm39) S373T probably damaging Het
Prop1 T C 11: 50,841,836 (GRCm39) D190G probably damaging Het
Qrich1 T A 9: 108,411,314 (GRCm39) Y280N probably damaging Het
Rasl10a T A 11: 5,009,519 (GRCm39) D102E probably benign Het
Rgs1 T C 1: 144,121,110 (GRCm39) Y187C probably damaging Het
Sema5b T A 16: 35,478,846 (GRCm39) W557R probably damaging Het
Sh2b3 A T 5: 121,966,520 (GRCm39) L198H probably damaging Het
Slc27a3 G T 3: 90,294,379 (GRCm39) T429K probably benign Het
Slc35f1 T G 10: 52,965,546 (GRCm39) D320E probably benign Het
Smug1 C A 15: 103,066,043 (GRCm39) probably null Het
Spata31f3 G A 4: 42,873,087 (GRCm39) T68I probably damaging Het
Ssrp1 T A 2: 84,871,512 (GRCm39) Y311* probably null Het
Svep1 T C 4: 58,096,223 (GRCm39) T1466A possibly damaging Het
Tmem130 A G 5: 144,687,749 (GRCm39) S196P probably damaging Het
Trim30d A T 7: 104,121,535 (GRCm39) C176* probably null Het
Ush2a A G 1: 188,169,159 (GRCm39) H1100R probably benign Het
Vezt A T 10: 93,832,957 (GRCm39) F151L probably benign Het
Vps35l A G 7: 118,396,234 (GRCm39) T538A possibly damaging Het
Zc3h3 G T 15: 75,651,380 (GRCm39) C638* probably null Het
Zfp128 C T 7: 12,618,654 (GRCm39) R51C probably damaging Het
Zfp141 T G 7: 42,125,855 (GRCm39) I206L possibly damaging Het
Zfp369 G T 13: 65,443,494 (GRCm39) K324N probably benign Het
Other mutations in Mcpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0104:Mcpt1 UTSW 14 56,256,888 (GRCm39) missense possibly damaging 0.65
R1458:Mcpt1 UTSW 14 56,256,621 (GRCm39) splice site probably benign
R1473:Mcpt1 UTSW 14 56,256,990 (GRCm39) missense probably benign 0.01
R1939:Mcpt1 UTSW 14 56,256,546 (GRCm39) missense possibly damaging 0.95
R2907:Mcpt1 UTSW 14 56,257,580 (GRCm39) missense probably damaging 0.99
R3966:Mcpt1 UTSW 14 56,256,503 (GRCm39) missense probably benign 0.14
R4235:Mcpt1 UTSW 14 56,256,017 (GRCm39) critical splice acceptor site probably null
R4594:Mcpt1 UTSW 14 56,256,109 (GRCm39) missense probably benign 0.00
R4754:Mcpt1 UTSW 14 56,256,137 (GRCm39) missense probably damaging 1.00
R4836:Mcpt1 UTSW 14 56,257,017 (GRCm39) missense probably damaging 1.00
R5888:Mcpt1 UTSW 14 56,256,969 (GRCm39) missense probably benign 0.14
R6925:Mcpt1 UTSW 14 56,256,522 (GRCm39) missense probably damaging 1.00
R7780:Mcpt1 UTSW 14 56,256,609 (GRCm39) critical splice donor site probably null
R8712:Mcpt1 UTSW 14 56,256,170 (GRCm39) critical splice donor site probably benign
R8885:Mcpt1 UTSW 14 56,256,522 (GRCm39) missense probably damaging 1.00
R8903:Mcpt1 UTSW 14 56,257,520 (GRCm39) missense probably benign 0.14
R9307:Mcpt1 UTSW 14 56,256,867 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATGTGGAAGTTCCTGATCCCC -3'
(R):5'- CTGTGTAAGGAGAGCCCATC -3'

Sequencing Primer
(F):5'- GAAGTTCCTGATCCCCACTCGAG -3'
(R):5'- GAGAAACCTCTTACCTTCC -3'
Posted On 2016-11-21