Incidental Mutation 'R5743:Kcnk4'
ID445699
Institutional Source Beutler Lab
Gene Symbol Kcnk4
Ensembl Gene ENSMUSG00000024957
Gene Namepotassium channel, subfamily K, member 4
SynonymsTRAAKt
MMRRC Submission 043353-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5743 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location6925710-6934515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6928355 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 81 (N81K)
Ref Sequence ENSEMBL: ENSMUSP00000025908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025908] [ENSMUST00000057716]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025908
AA Change: N81K

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025908
Gene: ENSMUSG00000024957
AA Change: N81K

DomainStartEndE-ValueType
Pfam:Ion_trans 2 147 8.1e-9 PFAM
Pfam:Ion_trans_2 64 145 1.7e-21 PFAM
Pfam:Ion_trans_2 174 260 5.3e-22 PFAM
low complexity region 303 319 N/A INTRINSIC
low complexity region 367 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057716
SMART Domains Protein: ENSMUSP00000056681
Gene: ENSMUSG00000050623

DomainStartEndE-ValueType
low complexity region 104 118 N/A INTRINSIC
low complexity region 137 146 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TWIK-related arachidonic acid-stimulated two pore potassium channel subfamily. The encoded protein homodimerizes and functions as an outwardly rectifying channel. This channel is regulated by polyunsaturated fatty acids, temperature and mechanical deformation of the lipid membrane. This protein is expressed primarily in neural tissues and may be involved in regulating the noxious input threshold in dorsal root ganglia neurons. Alternate splicing results in multiple transcript variants. Naturally occurring read-through transcripts also exist between this gene and the downstream testis expressed 40 (TEX40) gene, as represented in GeneID: 106780802. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit normal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,797,011 T538A possibly damaging Het
Acss2 A G 2: 155,574,616 probably benign Het
Ankef1 A G 2: 136,549,709 probably null Het
Arhgap20 T A 9: 51,816,727 M80K probably benign Het
Arhgap29 T G 3: 121,981,911 L37R probably damaging Het
Baiap3 G A 17: 25,244,785 P906S probably benign Het
Caskin2 T A 11: 115,802,289 N603I possibly damaging Het
Ccdc159 A T 9: 21,929,390 E84D probably benign Het
Ccl1 T G 11: 82,176,886 S73R possibly damaging Het
Cdh7 G T 1: 110,108,845 C585F probably damaging Het
Cga T C 4: 34,904,108 probably null Het
Coq5 A C 5: 115,279,882 E57A probably benign Het
Cstf1 T A 2: 172,377,833 L288Q probably damaging Het
Ctsll3 G T 13: 60,801,001 Q47K probably benign Het
Dchs1 T A 7: 105,771,596 Q539L probably benign Het
Fam205c G A 4: 42,873,087 T68I probably damaging Het
Fbxo46 C A 7: 19,136,495 D346E probably damaging Het
Frem3 A T 8: 80,615,778 T1567S probably damaging Het
Glce T A 9: 62,070,540 T21S probably damaging Het
Gm16432 G T 1: 178,122,762 silent Het
Gm19402 C T 10: 77,690,682 D26N probably damaging Het
Gm20830 A G Y: 6,916,664 Y152H probably damaging Het
Herc3 T C 6: 58,918,799 Y1011H probably benign Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Il31ra G T 13: 112,527,487 T552K possibly damaging Het
Itga2 A G 13: 114,884,506 V86A probably damaging Het
Lrp2 C A 2: 69,466,877 D3247Y probably damaging Het
Maml3 G T 3: 52,104,132 F4L unknown Het
Mcpt1 A T 14: 56,018,615 H37L probably benign Het
Mpdz T C 4: 81,421,188 M1V probably null Het
Myom2 A T 8: 15,080,914 K283N possibly damaging Het
Nrxn1 C A 17: 90,643,224 R509L probably damaging Het
Ntng1 T A 3: 110,135,420 Y30F probably damaging Het
Olfr1098 C A 2: 86,923,205 G109V probably benign Het
Olfr676 A G 7: 105,036,156 probably null Het
Olfr891 C A 9: 38,180,718 C35F probably benign Het
Orc6 A T 8: 85,302,956 Q43L probably benign Het
Otogl G A 10: 107,857,001 S874L possibly damaging Het
Pcdh9 T C 14: 93,886,724 D670G probably damaging Het
Pcdhga9 A T 18: 37,738,806 I563F probably damaging Het
Plxna1 A T 6: 89,356,529 S373T probably damaging Het
Prop1 T C 11: 50,951,009 D190G probably damaging Het
Qrich1 T A 9: 108,534,115 Y280N probably damaging Het
Rasl10a T A 11: 5,059,519 D102E probably benign Het
Rgs1 T C 1: 144,245,372 Y187C probably damaging Het
Sema5b T A 16: 35,658,476 W557R probably damaging Het
Sh2b3 A T 5: 121,828,457 L198H probably damaging Het
Slc27a3 G T 3: 90,387,072 T429K probably benign Het
Slc35f1 T G 10: 53,089,450 D320E probably benign Het
Smug1 C A 15: 103,157,616 probably null Het
Ssrp1 T A 2: 85,041,168 Y311* probably null Het
Svep1 T C 4: 58,096,223 T1466A possibly damaging Het
Tmem130 A G 5: 144,750,939 S196P probably damaging Het
Trim30d A T 7: 104,472,328 C176* probably null Het
Ush2a A G 1: 188,436,962 H1100R probably benign Het
Vezt A T 10: 93,997,095 F151L probably benign Het
Zc3h3 G T 15: 75,779,531 C638* probably null Het
Zfp128 C T 7: 12,884,727 R51C probably damaging Het
Zfp141 T G 7: 42,476,431 I206L possibly damaging Het
Zfp369 G T 13: 65,295,680 K324N probably benign Het
Other mutations in Kcnk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Kcnk4 APN 19 6927177 missense probably damaging 1.00
IGL02047:Kcnk4 APN 19 6926258 missense probably benign 0.00
IGL02726:Kcnk4 APN 19 6927089 critical splice donor site probably null
R0149:Kcnk4 UTSW 19 6926194 missense probably benign 0.08
R0617:Kcnk4 UTSW 19 6928160 unclassified probably benign
R1392:Kcnk4 UTSW 19 6927663 missense possibly damaging 0.80
R1392:Kcnk4 UTSW 19 6927663 missense possibly damaging 0.80
R3017:Kcnk4 UTSW 19 6927794 missense probably damaging 0.96
R4439:Kcnk4 UTSW 19 6932761 missense probably benign 0.01
R4895:Kcnk4 UTSW 19 6928416 splice site probably null
R5208:Kcnk4 UTSW 19 6927701 missense possibly damaging 0.79
R5409:Kcnk4 UTSW 19 6926210 missense probably benign 0.00
R6233:Kcnk4 UTSW 19 6928329 missense probably benign 0.29
R6466:Kcnk4 UTSW 19 6928297 missense probably damaging 1.00
R7358:Kcnk4 UTSW 19 6926110 missense probably damaging 1.00
R8040:Kcnk4 UTSW 19 6927627 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAATTCTAAGTGCCACCTGGT -3'
(R):5'- ACAGTGAGGGAGACATCTCA -3'

Sequencing Primer
(F):5'- GTGCCACCTGGTACCCC -3'
(R):5'- CAGTGAGGGAGACATCTCAAAAAC -3'
Posted On2016-11-21