Incidental Mutation 'R5744:Olfr825'
ID445724
Institutional Source Beutler Lab
Gene Symbol Olfr825
Ensembl Gene ENSMUSG00000058084
Gene Nameolfactory receptor 825
SynonymsGA_x6K02T2PULF-11834065-11833103, MOR210-1
MMRRC Submission 043197-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R5744 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location130159732-130166766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130162792 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 178 (D178G)
Ref Sequence ENSEMBL: ENSMUSP00000149981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076814] [ENSMUST00000216530]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076814
AA Change: D178G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076091
Gene: ENSMUSG00000058084
AA Change: D178G

DomainStartEndE-ValueType
Pfam:7tm_4 34 309 8.8e-54 PFAM
Pfam:7TM_GPCR_Srsx 38 251 9.6e-6 PFAM
Pfam:7tm_1 44 291 2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216434
Predicted Effect possibly damaging
Transcript: ENSMUST00000216530
AA Change: D178G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218167
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A G 12: 55,565,346 I19V possibly damaging Het
Ascc3 T C 10: 50,710,881 I943T probably benign Het
Btaf1 T C 19: 37,004,490 V1640A probably benign Het
Cep250 T C 2: 155,981,474 F1015S possibly damaging Het
Cgnl1 G T 9: 71,630,675 probably null Het
Csgalnact2 C T 6: 118,126,236 G255E probably damaging Het
Ctla2a C T 13: 60,935,953 probably null Het
Dip2c A T 13: 9,568,405 I497F probably damaging Het
Eif3f C A 7: 108,938,417 T179K probably damaging Het
Frem2 A G 3: 53,655,959 F376L probably damaging Het
Gemin4 A T 11: 76,212,165 F590Y probably damaging Het
Gemin5 C A 11: 58,155,183 C433F possibly damaging Het
Gm7694 C T 1: 170,302,506 probably null Het
Gpr158 G A 2: 21,368,520 G89R probably damaging Het
Herc1 C T 9: 66,508,193 P4817S probably damaging Het
Hs6st3 T C 14: 119,138,440 L9P possibly damaging Het
Igdcc3 TGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGC 9: 65,141,488 probably benign Het
Il1rap A C 16: 26,680,224 I158L probably benign Het
Itpr2 A G 6: 146,376,151 S640P probably damaging Het
Metrn A G 17: 25,795,237 V205A probably damaging Het
Mfhas1 C A 8: 35,589,482 D370E probably damaging Het
Mn1 T C 5: 111,420,536 S791P possibly damaging Het
Mtmr3 A G 11: 4,487,679 V925A possibly damaging Het
Neil1 T C 9: 57,144,201 T278A probably damaging Het
Nol8 A G 13: 49,662,326 N619D possibly damaging Het
Nup214 T C 2: 32,010,296 L879P probably damaging Het
Olfr1353 T C 10: 78,970,183 F178S probably damaging Het
Olfr167 A G 16: 19,515,336 I100T probably benign Het
Plxna1 C T 6: 89,334,682 R947Q possibly damaging Het
Prdm16 A G 4: 154,528,704 S89P probably damaging Het
Reln A C 5: 22,106,083 S277R probably null Het
Sel1l A T 12: 91,809,980 I746N possibly damaging Het
Slc2a8 C T 2: 32,976,028 D291N probably benign Het
Slc7a5 T C 8: 121,888,382 N242S probably benign Het
Smco3 T C 6: 136,831,765 N37S probably damaging Het
Sult1c1 T A 17: 53,973,962 K38* probably null Het
Tfap2b T C 1: 19,219,221 M190T probably benign Het
Tnpo2 T A 8: 85,051,894 Y623* probably null Het
Tomm70a G T 16: 57,121,839 probably benign Het
Ttyh2 T C 11: 114,702,310 probably null Het
Zbtb10 A G 3: 9,264,563 Y327C probably damaging Het
Other mutations in Olfr825
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03244:Olfr825 APN 10 130162400 nonsense probably null
R1120:Olfr825 UTSW 10 130162537 missense probably damaging 1.00
R1341:Olfr825 UTSW 10 130163316 missense probably benign 0.00
R1754:Olfr825 UTSW 10 130163164 missense probably benign 0.02
R2022:Olfr825 UTSW 10 130163180 missense probably benign 0.00
R2027:Olfr825 UTSW 10 130162735 missense probably benign 0.00
R3838:Olfr825 UTSW 10 130162406 nonsense probably null
R3842:Olfr825 UTSW 10 130162901 missense probably benign 0.00
R4737:Olfr825 UTSW 10 130162838 missense probably benign 0.01
R5166:Olfr825 UTSW 10 130162561 missense possibly damaging 0.60
R5899:Olfr825 UTSW 10 130162673 missense probably benign 0.00
X0026:Olfr825 UTSW 10 130162731 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAAGTGGAGAAGGCTTTC -3'
(R):5'- CATTGTGGCTGAAGGATTTCTCC -3'

Sequencing Primer
(F):5'- CTTCCTTCCCTCCACGGATCG -3'
(R):5'- GGATTTCTCCTGGCAGCCATG -3'
Posted On2016-11-21