Incidental Mutation 'R5744:Dip2c'
ID445730
Institutional Source Beutler Lab
Gene Symbol Dip2c
Ensembl Gene ENSMUSG00000048264
Gene Namedisco interacting protein 2 homolog C
Synonyms2900024P20Rik
MMRRC Submission 043197-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.578) question?
Stock #R5744 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location9276528-9668928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9568405 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 497 (I497F)
Ref Sequence ENSEMBL: ENSMUSP00000133806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]
Predicted Effect probably damaging
Transcript: ENSMUST00000166299
AA Change: I497F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: I497F

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 801 3.6e-23 PFAM
Pfam:AMP-binding 977 1451 1.5e-72 PFAM
low complexity region 1514 1526 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169960
AA Change: I553F

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: I553F

DomainStartEndE-ValueType
DMAP_binding 7 176 3.02e-37 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Pfam:AMP-binding 380 637 5.9e-10 PFAM
SCOP:d1lci__ 675 875 2e-8 SMART
Pfam:AMP-binding 947 1421 1.2e-56 PFAM
low complexity region 1484 1496 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174552
AA Change: I497F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: I497F

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 800 2.7e-20 PFAM
Pfam:AMP-binding 976 1450 1.3e-56 PFAM
low complexity region 1513 1525 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A G 12: 55,565,346 I19V possibly damaging Het
Ascc3 T C 10: 50,710,881 I943T probably benign Het
Btaf1 T C 19: 37,004,490 V1640A probably benign Het
Cep250 T C 2: 155,981,474 F1015S possibly damaging Het
Cgnl1 G T 9: 71,630,675 probably null Het
Csgalnact2 C T 6: 118,126,236 G255E probably damaging Het
Ctla2a C T 13: 60,935,953 probably null Het
Eif3f C A 7: 108,938,417 T179K probably damaging Het
Frem2 A G 3: 53,655,959 F376L probably damaging Het
Gemin4 A T 11: 76,212,165 F590Y probably damaging Het
Gemin5 C A 11: 58,155,183 C433F possibly damaging Het
Gm7694 C T 1: 170,302,506 probably null Het
Gpr158 G A 2: 21,368,520 G89R probably damaging Het
Herc1 C T 9: 66,508,193 P4817S probably damaging Het
Hs6st3 T C 14: 119,138,440 L9P possibly damaging Het
Igdcc3 TGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGC 9: 65,141,488 probably benign Het
Il1rap A C 16: 26,680,224 I158L probably benign Het
Itpr2 A G 6: 146,376,151 S640P probably damaging Het
Metrn A G 17: 25,795,237 V205A probably damaging Het
Mfhas1 C A 8: 35,589,482 D370E probably damaging Het
Mn1 T C 5: 111,420,536 S791P possibly damaging Het
Mtmr3 A G 11: 4,487,679 V925A possibly damaging Het
Neil1 T C 9: 57,144,201 T278A probably damaging Het
Nol8 A G 13: 49,662,326 N619D possibly damaging Het
Nup214 T C 2: 32,010,296 L879P probably damaging Het
Olfr1353 T C 10: 78,970,183 F178S probably damaging Het
Olfr167 A G 16: 19,515,336 I100T probably benign Het
Olfr825 T C 10: 130,162,792 D178G possibly damaging Het
Plxna1 C T 6: 89,334,682 R947Q possibly damaging Het
Prdm16 A G 4: 154,528,704 S89P probably damaging Het
Reln A C 5: 22,106,083 S277R probably null Het
Sel1l A T 12: 91,809,980 I746N possibly damaging Het
Slc2a8 C T 2: 32,976,028 D291N probably benign Het
Slc7a5 T C 8: 121,888,382 N242S probably benign Het
Smco3 T C 6: 136,831,765 N37S probably damaging Het
Sult1c1 T A 17: 53,973,962 K38* probably null Het
Tfap2b T C 1: 19,219,221 M190T probably benign Het
Tnpo2 T A 8: 85,051,894 Y623* probably null Het
Tomm70a G T 16: 57,121,839 probably benign Het
Ttyh2 T C 11: 114,702,310 probably null Het
Zbtb10 A G 3: 9,264,563 Y327C probably damaging Het
Other mutations in Dip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dip2c APN 13 9493108 missense probably damaging 0.97
IGL00426:Dip2c APN 13 9606515 missense probably damaging 1.00
IGL00503:Dip2c APN 13 9567898 missense probably damaging 1.00
IGL00586:Dip2c APN 13 9610755 missense probably damaging 1.00
IGL01306:Dip2c APN 13 9575143 missense possibly damaging 0.72
IGL01580:Dip2c APN 13 9637088 splice site probably null
IGL01985:Dip2c APN 13 9553267 splice site probably benign
IGL02060:Dip2c APN 13 9622630 missense probably damaging 0.98
IGL02122:Dip2c APN 13 9506659 missense possibly damaging 0.48
IGL02170:Dip2c APN 13 9606335 missense probably benign 0.03
IGL02211:Dip2c APN 13 9610847 missense probably damaging 1.00
IGL02755:Dip2c APN 13 9550320 critical splice donor site probably null
IGL02836:Dip2c APN 13 9610790 missense probably damaging 0.98
IGL02935:Dip2c APN 13 9662146 missense probably damaging 1.00
IGL03032:Dip2c APN 13 9551778 missense probably damaging 1.00
ANU23:Dip2c UTSW 13 9575143 missense possibly damaging 0.72
P0038:Dip2c UTSW 13 9646982 missense probably damaging 1.00
R0009:Dip2c UTSW 13 9621903 missense probably damaging 1.00
R0268:Dip2c UTSW 13 9637150 missense probably damaging 1.00
R0271:Dip2c UTSW 13 9615775 missense probably damaging 1.00
R0306:Dip2c UTSW 13 9604599 missense probably benign 0.09
R0415:Dip2c UTSW 13 9568289 splice site probably benign
R0519:Dip2c UTSW 13 9563208 missense probably damaging 1.00
R0557:Dip2c UTSW 13 9553459 missense possibly damaging 0.81
R0964:Dip2c UTSW 13 9568663 missense probably benign 0.43
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0974:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R1101:Dip2c UTSW 13 9634744 missense probably damaging 1.00
R1171:Dip2c UTSW 13 9493126 missense possibly damaging 0.89
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1432:Dip2c UTSW 13 9553304 missense probably damaging 0.99
R1481:Dip2c UTSW 13 9551866 critical splice donor site probably null
R1588:Dip2c UTSW 13 9665864 missense probably damaging 1.00
R1721:Dip2c UTSW 13 9659368 missense probably damaging 1.00
R1726:Dip2c UTSW 13 9575428 missense probably damaging 1.00
R1867:Dip2c UTSW 13 9621949 missense possibly damaging 0.55
R1909:Dip2c UTSW 13 9533350 missense probably benign 0.00
R2013:Dip2c UTSW 13 9567846 nonsense probably null
R2022:Dip2c UTSW 13 9551800 missense probably damaging 1.00
R2517:Dip2c UTSW 13 9609005 missense probably damaging 1.00
R3746:Dip2c UTSW 13 9601473 missense probably damaging 1.00
R3794:Dip2c UTSW 13 9604561 missense probably damaging 0.99
R3884:Dip2c UTSW 13 9551858 missense probably damaging 1.00
R4019:Dip2c UTSW 13 9614365 missense probably damaging 0.99
R4110:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4111:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4113:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4256:Dip2c UTSW 13 9609056 missense probably damaging 1.00
R4300:Dip2c UTSW 13 9610711 missense probably damaging 1.00
R4494:Dip2c UTSW 13 9571062 missense possibly damaging 0.64
R4739:Dip2c UTSW 13 9533339 missense probably damaging 0.98
R4812:Dip2c UTSW 13 9637130 nonsense probably null
R4814:Dip2c UTSW 13 9536860 missense probably benign 0.07
R4816:Dip2c UTSW 13 9575150 missense probably benign 0.37
R4828:Dip2c UTSW 13 9560679 missense probably damaging 1.00
R4915:Dip2c UTSW 13 9621869 splice site probably null
R4917:Dip2c UTSW 13 9621869 splice site probably null
R4932:Dip2c UTSW 13 9623972 missense probably damaging 0.99
R4993:Dip2c UTSW 13 9575223 nonsense probably null
R5043:Dip2c UTSW 13 9551827 missense possibly damaging 0.80
R5349:Dip2c UTSW 13 9622653 missense probably damaging 1.00
R5840:Dip2c UTSW 13 9506676 missense possibly damaging 0.68
R6110:Dip2c UTSW 13 9623766 missense probably damaging 1.00
R6160:Dip2c UTSW 13 9533254 missense probably benign 0.01
R6161:Dip2c UTSW 13 9647007 missense probably damaging 1.00
R6477:Dip2c UTSW 13 9623760 missense probably damaging 1.00
R6522:Dip2c UTSW 13 9575228 critical splice donor site probably null
R6603:Dip2c UTSW 13 9654588 splice site probably null
R6658:Dip2c UTSW 13 9493177 critical splice donor site probably null
R6672:Dip2c UTSW 13 9567830 critical splice acceptor site probably null
R6697:Dip2c UTSW 13 9621913 missense probably damaging 1.00
R6991:Dip2c UTSW 13 9551860 nonsense probably null
R6991:Dip2c UTSW 13 9634832 missense probably damaging 1.00
R7018:Dip2c UTSW 13 9659278 missense probably damaging 1.00
R7053:Dip2c UTSW 13 9610704 missense probably damaging 1.00
R7102:Dip2c UTSW 13 9604536 missense probably benign 0.01
R7171:Dip2c UTSW 13 9506648 missense probably benign 0.34
R7371:Dip2c UTSW 13 9592749 missense probably benign 0.02
R7395:Dip2c UTSW 13 9614377 missense probably damaging 1.00
R7489:Dip2c UTSW 13 9533312 missense probably damaging 0.99
R7575:Dip2c UTSW 13 9628012 missense probably damaging 0.97
R7642:Dip2c UTSW 13 9622705 critical splice donor site probably null
R7687:Dip2c UTSW 13 9604581 missense probably benign 0.00
R7699:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7700:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7715:Dip2c UTSW 13 9614391 missense probably damaging 1.00
R7842:Dip2c UTSW 13 9606533 critical splice donor site probably null
R7845:Dip2c UTSW 13 9609044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGAAGTGCTTGAAACCAAG -3'
(R):5'- ACGTCTTATACTGAAACGAGACAG -3'

Sequencing Primer
(F):5'- CTTGAAACCAAGCTGTGAAGTAAAG -3'
(R):5'- ACAGAAAATATGGAAAGGTGTTTGG -3'
Posted On2016-11-21