Incidental Mutation 'R5744:Hs6st3'
ID445733
Institutional Source Beutler Lab
Gene Symbol Hs6st3
Ensembl Gene ENSMUSG00000053465
Gene Nameheparan sulfate 6-O-sulfotransferase 3
Synonyms6OST3
MMRRC Submission 043197-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R5744 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location119138341-119869815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119138440 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 9 (L9P)
Ref Sequence ENSEMBL: ENSMUSP00000070394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065904]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065904
AA Change: L9P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000070394
Gene: ENSMUSG00000053465
AA Change: L9P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 46 61 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 86 115 N/A INTRINSIC
Pfam:Sulfotransfer_2 137 410 4.7e-83 PFAM
low complexity region 425 447 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate (HS) sulfotransferases, such as HS6ST3, modify HS to generate structures required for interactions between HS and a variety of proteins. These interactions are implicated in proliferation and differentiation, adhesion, migration, inflammation, blood coagulation, and other diverse processes (Habuchi et al., 2000 [PubMed 10644753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A G 12: 55,565,346 I19V possibly damaging Het
Ascc3 T C 10: 50,710,881 I943T probably benign Het
Btaf1 T C 19: 37,004,490 V1640A probably benign Het
Cep250 T C 2: 155,981,474 F1015S possibly damaging Het
Cgnl1 G T 9: 71,630,675 probably null Het
Csgalnact2 C T 6: 118,126,236 G255E probably damaging Het
Ctla2a C T 13: 60,935,953 probably null Het
Dip2c A T 13: 9,568,405 I497F probably damaging Het
Eif3f C A 7: 108,938,417 T179K probably damaging Het
Frem2 A G 3: 53,655,959 F376L probably damaging Het
Gemin4 A T 11: 76,212,165 F590Y probably damaging Het
Gemin5 C A 11: 58,155,183 C433F possibly damaging Het
Gm7694 C T 1: 170,302,506 probably null Het
Gpr158 G A 2: 21,368,520 G89R probably damaging Het
Herc1 C T 9: 66,508,193 P4817S probably damaging Het
Igdcc3 TGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGC 9: 65,141,488 probably benign Het
Il1rap A C 16: 26,680,224 I158L probably benign Het
Itpr2 A G 6: 146,376,151 S640P probably damaging Het
Metrn A G 17: 25,795,237 V205A probably damaging Het
Mfhas1 C A 8: 35,589,482 D370E probably damaging Het
Mn1 T C 5: 111,420,536 S791P possibly damaging Het
Mtmr3 A G 11: 4,487,679 V925A possibly damaging Het
Neil1 T C 9: 57,144,201 T278A probably damaging Het
Nol8 A G 13: 49,662,326 N619D possibly damaging Het
Nup214 T C 2: 32,010,296 L879P probably damaging Het
Olfr1353 T C 10: 78,970,183 F178S probably damaging Het
Olfr167 A G 16: 19,515,336 I100T probably benign Het
Olfr825 T C 10: 130,162,792 D178G possibly damaging Het
Plxna1 C T 6: 89,334,682 R947Q possibly damaging Het
Prdm16 A G 4: 154,528,704 S89P probably damaging Het
Reln A C 5: 22,106,083 S277R probably null Het
Sel1l A T 12: 91,809,980 I746N possibly damaging Het
Slc2a8 C T 2: 32,976,028 D291N probably benign Het
Slc7a5 T C 8: 121,888,382 N242S probably benign Het
Smco3 T C 6: 136,831,765 N37S probably damaging Het
Sult1c1 T A 17: 53,973,962 K38* probably null Het
Tfap2b T C 1: 19,219,221 M190T probably benign Het
Tnpo2 T A 8: 85,051,894 Y623* probably null Het
Tomm70a G T 16: 57,121,839 probably benign Het
Ttyh2 T C 11: 114,702,310 probably null Het
Zbtb10 A G 3: 9,264,563 Y327C probably damaging Het
Other mutations in Hs6st3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Hs6st3 APN 14 119139034 missense probably damaging 1.00
IGL00973:Hs6st3 APN 14 119869407 missense possibly damaging 0.58
IGL02185:Hs6st3 APN 14 119868884 critical splice acceptor site probably null
IGL02696:Hs6st3 APN 14 119869319 missense probably damaging 0.98
IGL02820:Hs6st3 APN 14 119139080 missense possibly damaging 0.95
R0241:Hs6st3 UTSW 14 119138820 missense probably benign 0.32
R0241:Hs6st3 UTSW 14 119138820 missense probably benign 0.32
R0634:Hs6st3 UTSW 14 119869062 nonsense probably null
R0737:Hs6st3 UTSW 14 119869383 missense possibly damaging 0.82
R0750:Hs6st3 UTSW 14 119138707 small deletion probably benign
R1975:Hs6st3 UTSW 14 119138476 missense probably benign 0.33
R1977:Hs6st3 UTSW 14 119138476 missense probably benign 0.33
R2025:Hs6st3 UTSW 14 119869389 missense probably damaging 1.00
R2116:Hs6st3 UTSW 14 119869287 missense probably damaging 1.00
R2295:Hs6st3 UTSW 14 119138445 missense probably benign 0.15
R3154:Hs6st3 UTSW 14 119868977 missense probably damaging 0.99
R5700:Hs6st3 UTSW 14 119138787 nonsense probably null
R5852:Hs6st3 UTSW 14 119869326 missense probably damaging 1.00
R5861:Hs6st3 UTSW 14 119138853 missense possibly damaging 0.89
R6262:Hs6st3 UTSW 14 119138991 missense possibly damaging 0.95
R6408:Hs6st3 UTSW 14 119138634 missense probably benign 0.44
R7140:Hs6st3 UTSW 14 119139102 missense probably damaging 1.00
R7598:Hs6st3 UTSW 14 119869338 missense probably damaging 1.00
R8026:Hs6st3 UTSW 14 119869556 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCAGGTACAAGAGGAGCC -3'
(R):5'- ACTCATCAAGGGGTGCTTGTG -3'

Sequencing Primer
(F):5'- ATCGAGAGGAGCCCCAC -3'
(R):5'- GGGTGCTTGTGCCCGTC -3'
Posted On2016-11-21