Incidental Mutation 'R5745:Pms1'
ID 445740
Institutional Source Beutler Lab
Gene Symbol Pms1
Ensembl Gene ENSMUSG00000026098
Gene Name PMS1 homolog 1, mismatch repair system component
Synonyms
MMRRC Submission 043198-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5745 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 53228346-53336177 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 53246861 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 280 (Y280*)
Ref Sequence ENSEMBL: ENSMUSP00000119632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027267] [ENSMUST00000135246]
AlphaFold Q8K119
Predicted Effect probably null
Transcript: ENSMUST00000027267
AA Change: Y280*
SMART Domains Protein: ENSMUSP00000027267
Gene: ENSMUSG00000026098
AA Change: Y280*

DomainStartEndE-ValueType
HATPase_c 16 151 3.84e-1 SMART
DNA_mis_repair 210 338 2.46e-25 SMART
low complexity region 457 474 N/A INTRINSIC
HMG 557 627 1.42e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135246
AA Change: Y280*
SMART Domains Protein: ENSMUSP00000119632
Gene: ENSMUSG00000026098
AA Change: Y280*

DomainStartEndE-ValueType
HATPase_c 16 151 3.84e-1 SMART
DNA_mis_repair 210 338 2.46e-25 SMART
low complexity region 457 474 N/A INTRINSIC
HMG 557 627 1.42e-17 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the DNA mismatch repair mutL/hexB family. This protein is thought to be involved in the repair of DNA mismatches, and it can form heterodimers with MLH1, a known DNA mismatch repair protein. Mutations in this gene cause hereditary nonpolyposis colorectal cancer type 3 (HNPCC3) either alone or in combination with mutations in other genes involved in the HNPCC phenotype, which is also known as Lynch syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a modest increase in DNA mismatch repair errors, primarily single base pair substitutions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,349,828 (GRCm39) R74W probably damaging Het
4933407L21Rik T G 1: 85,858,995 (GRCm39) probably null Het
Adcy8 A T 15: 64,792,320 (GRCm39) I212N possibly damaging Het
Cobll1 T C 2: 64,928,801 (GRCm39) T879A probably damaging Het
Copb2 T C 9: 98,456,164 (GRCm39) S233P probably damaging Het
Cpa5 T A 6: 30,630,436 (GRCm39) M330K probably damaging Het
Dgcr8 A T 16: 18,098,307 (GRCm39) N361K probably benign Het
Dmxl1 A G 18: 49,979,653 (GRCm39) E96G probably benign Het
Dock8 T A 19: 25,107,761 (GRCm39) N830K probably benign Het
Ephb1 C T 9: 102,072,633 (GRCm39) D49N probably benign Het
Fer1l6 A G 15: 58,443,238 (GRCm39) I514V probably benign Het
Fpr1 A G 17: 18,097,344 (GRCm39) I215T probably benign Het
Hectd4 G A 5: 121,491,565 (GRCm39) V3668M possibly damaging Het
Ighv3-4 T A 12: 114,217,388 (GRCm39) I68L probably benign Het
Intu A G 3: 40,647,402 (GRCm39) probably null Het
Kel C T 6: 41,675,961 (GRCm39) G243E probably damaging Het
Mycbp2 A C 14: 103,393,889 (GRCm39) S2781A possibly damaging Het
Myom2 T A 8: 15,172,705 (GRCm39) S1211T probably benign Het
Nrp1 A T 8: 129,194,929 (GRCm39) I462F probably benign Het
Or10d3 T C 9: 39,461,987 (GRCm39) Y60C probably damaging Het
Or6c5c T A 10: 129,299,307 (GRCm39) I254N probably damaging Het
Pcsk1 A C 13: 75,280,079 (GRCm39) S635R probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,127 (GRCm39) probably benign Het
Sema3b C A 9: 107,478,628 (GRCm39) A356S probably damaging Het
Shoc2 C A 19: 54,018,323 (GRCm39) T485K probably benign Het
Slc7a7 G A 14: 54,615,292 (GRCm39) S235L possibly damaging Het
Smcr8 A T 11: 60,674,977 (GRCm39) T918S probably benign Het
Tafa1 G A 6: 96,626,146 (GRCm39) R128Q probably damaging Het
Tle3 C A 9: 61,322,133 (GRCm39) F719L probably damaging Het
Vmn2r45 T A 7: 8,486,074 (GRCm39) I405L probably benign Het
Vmn2r57 A T 7: 41,097,895 (GRCm39) H57Q possibly damaging Het
Other mutations in Pms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Pms1 APN 1 53,245,715 (GRCm39) splice site probably benign
IGL00937:Pms1 APN 1 53,314,410 (GRCm39) missense possibly damaging 0.74
IGL01505:Pms1 APN 1 53,246,130 (GRCm39) missense probably benign
IGL02109:Pms1 APN 1 53,246,568 (GRCm39) missense probably damaging 0.96
IGL02245:Pms1 APN 1 53,246,519 (GRCm39) missense probably damaging 1.00
IGL02273:Pms1 APN 1 53,247,156 (GRCm39) missense probably damaging 1.00
IGL02339:Pms1 APN 1 53,314,324 (GRCm39) missense possibly damaging 0.78
R0157:Pms1 UTSW 1 53,234,196 (GRCm39) nonsense probably null
R0530:Pms1 UTSW 1 53,235,972 (GRCm39) splice site probably null
R1398:Pms1 UTSW 1 53,246,435 (GRCm39) missense possibly damaging 0.88
R1817:Pms1 UTSW 1 53,246,128 (GRCm39) missense probably benign 0.02
R1831:Pms1 UTSW 1 53,246,370 (GRCm39) missense probably benign 0.00
R1838:Pms1 UTSW 1 53,231,257 (GRCm39) critical splice donor site probably null
R1867:Pms1 UTSW 1 53,228,546 (GRCm39) missense probably benign 0.36
R1874:Pms1 UTSW 1 53,246,392 (GRCm39) missense probably benign 0.16
R1939:Pms1 UTSW 1 53,236,135 (GRCm39) missense probably damaging 1.00
R1991:Pms1 UTSW 1 53,321,201 (GRCm39) missense probably damaging 1.00
R1993:Pms1 UTSW 1 53,234,174 (GRCm39) missense probably benign
R1995:Pms1 UTSW 1 53,234,174 (GRCm39) missense probably benign
R2049:Pms1 UTSW 1 53,321,147 (GRCm39) missense probably damaging 0.99
R2058:Pms1 UTSW 1 53,314,327 (GRCm39) missense probably benign 0.00
R2140:Pms1 UTSW 1 53,321,147 (GRCm39) missense probably damaging 0.99
R4078:Pms1 UTSW 1 53,306,948 (GRCm39) splice site probably null
R4608:Pms1 UTSW 1 53,234,097 (GRCm39) missense possibly damaging 0.80
R4668:Pms1 UTSW 1 53,228,633 (GRCm39) nonsense probably null
R5164:Pms1 UTSW 1 53,246,799 (GRCm39) missense probably damaging 0.99
R5200:Pms1 UTSW 1 53,245,916 (GRCm39) missense probably benign 0.00
R5397:Pms1 UTSW 1 53,231,279 (GRCm39) nonsense probably null
R6440:Pms1 UTSW 1 53,234,180 (GRCm39) missense probably damaging 0.98
R6445:Pms1 UTSW 1 53,231,353 (GRCm39) missense possibly damaging 0.77
R6802:Pms1 UTSW 1 53,245,951 (GRCm39) missense probably benign 0.06
R6975:Pms1 UTSW 1 53,228,590 (GRCm39) missense probably damaging 0.99
R7020:Pms1 UTSW 1 53,228,541 (GRCm39) missense probably damaging 1.00
R7037:Pms1 UTSW 1 53,246,770 (GRCm39) missense possibly damaging 0.95
R7199:Pms1 UTSW 1 53,295,889 (GRCm39) missense probably benign 0.02
R7417:Pms1 UTSW 1 53,236,231 (GRCm39) missense probably benign 0.00
R7587:Pms1 UTSW 1 53,246,475 (GRCm39) missense probably benign 0.00
R7716:Pms1 UTSW 1 53,246,767 (GRCm39) missense probably damaging 1.00
R8178:Pms1 UTSW 1 53,246,505 (GRCm39) missense probably benign 0.00
R8336:Pms1 UTSW 1 53,245,985 (GRCm39) missense probably benign
R8399:Pms1 UTSW 1 53,307,091 (GRCm39) critical splice acceptor site probably null
R8692:Pms1 UTSW 1 53,246,052 (GRCm39) missense probably benign
R8736:Pms1 UTSW 1 53,307,053 (GRCm39) missense possibly damaging 0.63
R8738:Pms1 UTSW 1 53,321,195 (GRCm39) missense possibly damaging 0.67
R8751:Pms1 UTSW 1 53,231,269 (GRCm39) missense probably benign 0.01
R9102:Pms1 UTSW 1 53,307,021 (GRCm39) missense probably benign 0.11
R9294:Pms1 UTSW 1 53,247,216 (GRCm39) missense probably benign
R9648:Pms1 UTSW 1 53,314,284 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTCCGTAACAGGTCATC -3'
(R):5'- TTCTTCCCAAAGCACGATGC -3'

Sequencing Primer
(F):5'- TGGTCCGTAACAGGTCATCATCAG -3'
(R):5'- GTCTTTCAACCCCAGAGAGAAGTTTC -3'
Posted On 2016-11-21