Mutagenetix > Incidental Mutations

Incidental Mutation 'R5745:Cobll1'

445742

Institutional Source

Beutler Lab

Gene Symbol

Cobll1

Ensembl Gene

ENSMUSG00000034903

Gene Name

Cobl-like 1

Synonyms

D430044D16Rik, Coblr1

MMRRC Submission

043198-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.291) question?

Stock #

R5745 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65088339-65239403 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65098457 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 879 (T879A)

Ref Sequence

ENSEMBL: ENSMUSP00000099787 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090896] [ENSMUST00000102726] [ENSMUST00000112429] [ENSMUST00000112430] [ENSMUST00000112431]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090896
AA Change: T842A

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000088412
Gene: ENSMUSG00000034903
AA Change: T842A

Domain	Start	End	E-Value	Type
low complexity region	147	158	N/A	INTRINSIC
Pfam:Cobl	186	264	1.3e-38	PFAM
low complexity region	332	343	N/A	INTRINSIC
low complexity region	426	438	N/A	INTRINSIC
low complexity region	1023	1034	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102726
AA Change: T879A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099787
Gene: ENSMUSG00000034903
AA Change: T879A

Domain	Start	End	E-Value	Type
low complexity region	147	158	N/A	INTRINSIC
Pfam:Cobl	186	264	5.6e-39	PFAM
low complexity region	332	343	N/A	INTRINSIC
low complexity region	464	476	N/A	INTRINSIC
low complexity region	1060	1071	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112429
AA Change: T880A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000108048
Gene: ENSMUSG00000034903
AA Change: T880A

Domain	Start	End	E-Value	Type
Pfam:Cobl	148	239	5.4e-49	PFAM
low complexity region	332	343	N/A	INTRINSIC
low complexity region	464	476	N/A	INTRINSIC
low complexity region	1061	1072	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112430
AA Change: T841A

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000108049
Gene: ENSMUSG00000034903
AA Change: T841A

Domain	Start	End	E-Value	Type
low complexity region	146	157	N/A	INTRINSIC
Pfam:Cobl	185	263	1.3e-38	PFAM
low complexity region	331	342	N/A	INTRINSIC
low complexity region	425	437	N/A	INTRINSIC
low complexity region	1022	1033	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112431
AA Change: T880A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000108050
Gene: ENSMUSG00000034903
AA Change: T880A

Domain	Start	End	E-Value	Type
low complexity region	147	158	N/A	INTRINSIC
Pfam:Cobl	186	264	5.6e-39	PFAM
low complexity region	332	343	N/A	INTRINSIC
low complexity region	464	476	N/A	INTRINSIC
low complexity region	1061	1072	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155768

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110082I17Rik	G	A	5: 139,364,073	R74W	probably damaging	Het
4933407L21Rik	T	G	1: 85,931,274		probably null	Het
Adcy8	A	T	15: 64,920,471	I212N	possibly damaging	Het
Copb2	T	C	9: 98,574,111	S233P	probably damaging	Het
Cpa5	T	A	6: 30,630,437	M330K	probably damaging	Het
Dgcr8	A	T	16: 18,280,443	N361K	probably benign	Het
Dmxl1	A	G	18: 49,846,586	E96G	probably benign	Het
Dock8	T	A	19: 25,130,397	N830K	probably benign	Het
Ephb1	C	T	9: 102,195,434	D49N	probably benign	Het
Fam19a1	G	A	6: 96,649,185	R128Q	probably damaging	Het
Fer1l6	A	G	15: 58,571,389	I514V	probably benign	Het
Fpr1	A	G	17: 17,877,082	I215T	probably benign	Het
Hectd4	G	A	5: 121,353,502	V3668M	possibly damaging	Het
Ighv3-4	T	A	12: 114,253,768	I68L	probably benign	Het
Intu	A	G	3: 40,692,972		probably null	Het
Kel	C	T	6: 41,699,027	G243E	probably damaging	Het
Mycbp2	A	C	14: 103,156,453	S2781A	possibly damaging	Het
Myom2	T	A	8: 15,122,705	S1211T	probably benign	Het
Nrp1	A	T	8: 128,468,448	I462F	probably benign	Het
Olfr787	T	A	10: 129,463,438	I254N	probably damaging	Het
Olfr958	T	C	9: 39,550,691	Y60C	probably damaging	Het
Pcsk1	A	C	13: 75,131,960	S635R	probably benign	Het
Pms1	A	T	1: 53,207,702	Y280*	probably null	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,920		probably benign	Het
Sema3b	C	A	9: 107,601,429	A356S	probably damaging	Het
Shoc2	C	A	19: 54,029,892	T485K	probably benign	Het
Slc7a7	G	A	14: 54,377,835	S235L	possibly damaging	Het
Smcr8	A	T	11: 60,784,151	T918S	probably benign	Het
Tle3	C	A	9: 61,414,851	F719L	probably damaging	Het
Vmn2r45	T	A	7: 8,483,075	I405L	probably benign	Het
Vmn2r57	A	T	7: 41,448,471	H57Q	possibly damaging	Het

Other mutations in Cobll1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00789:Cobll1	APN	2	65126013	missense	probably damaging	1.00
IGL01074:Cobll1	APN	2	65107848	missense	probably damaging	1.00
IGL01093:Cobll1	APN	2	65098237	missense	probably damaging	1.00
IGL02411:Cobll1	APN	2	65097740	missense	probably damaging	1.00
IGL02419:Cobll1	APN	2	65151048	missense	probably damaging	1.00
IGL02550:Cobll1	APN	2	65107863	missense	probably damaging	1.00
IGL02607:Cobll1	APN	2	65151085	missense	probably damaging	0.98
IGL02829:Cobll1	APN	2	65126045	missense	probably damaging	1.00
IGL02802:Cobll1	UTSW	2	65098319	missense	probably damaging	0.99
R0313:Cobll1	UTSW	2	65095744	nonsense	probably null
R0314:Cobll1	UTSW	2	65089521	missense	possibly damaging	0.81
R0322:Cobll1	UTSW	2	65102098	missense	possibly damaging	0.84
R0846:Cobll1	UTSW	2	65102065	splice site	probably null
R1163:Cobll1	UTSW	2	65098279	missense	probably damaging	0.96
R1242:Cobll1	UTSW	2	65151169	critical splice acceptor site	probably null
R1364:Cobll1	UTSW	2	65126310	splice site	probably benign
R1445:Cobll1	UTSW	2	65099136	missense	probably damaging	1.00
R1610:Cobll1	UTSW	2	65133642	missense	probably damaging	1.00
R1836:Cobll1	UTSW	2	65126236	missense	probably damaging	1.00
R2102:Cobll1	UTSW	2	65098210	missense	probably damaging	1.00
R3154:Cobll1	UTSW	2	65107050	missense	probably benign	0.00
R4580:Cobll1	UTSW	2	65151073	missense	probably benign	0.00
R4638:Cobll1	UTSW	2	65099237	missense	probably benign	0.03
R4684:Cobll1	UTSW	2	65099028	missense	possibly damaging	0.90
R4906:Cobll1	UTSW	2	65097693	missense	probably benign	0.01
R4923:Cobll1	UTSW	2	65099258	missense	possibly damaging	0.87
R5100:Cobll1	UTSW	2	65125901	missense	probably benign	0.26
R5269:Cobll1	UTSW	2	65133771	nonsense	probably null
R5419:Cobll1	UTSW	2	65103357	missense	possibly damaging	0.57
R5637:Cobll1	UTSW	2	65125903	missense	possibly damaging	0.90
R5777:Cobll1	UTSW	2	65103268	missense	probably benign	0.27
R6303:Cobll1	UTSW	2	65098033	missense	possibly damaging	0.68
R6471:Cobll1	UTSW	2	65107884	missense	probably damaging	1.00
R7027:Cobll1	UTSW	2	65089503	missense	probably benign	0.00
R7132:Cobll1	UTSW	2	65133768	missense	probably damaging	1.00
R7197:Cobll1	UTSW	2	65098538	missense	probably benign	0.00
R7365:Cobll1	UTSW	2	65098373	missense	probably damaging	0.99
R7607:Cobll1	UTSW	2	65095857	missense	probably benign	0.02
R7899:Cobll1	UTSW	2	65125931	missense	probably damaging	1.00
R7996:Cobll1	UTSW	2	65150985	missense	possibly damaging	0.93
R8175:Cobll1	UTSW	2	65099231	missense	probably benign
R8212:Cobll1	UTSW	2	65102080	missense	probably benign	0.08
R8549:Cobll1	UTSW	2	65098450	missense	probably damaging	1.00
X0020:Cobll1	UTSW	2	65103322	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTAGCAGCTGCAGATGTCAC -3'
(R):5'- TCCCTGGAAATGGCGAAAGAC -3'

Sequencing Primer
(F):5'- TGCAGATGTCACATAGTGGCC -3'
(R):5'- TGACCAAAAGATGCTCCCTGTAGG -3'

Posted On

2016-11-21